ID: 1004817457

View in Genome Browser
Species Human (GRCh38)
Location 6:19327820-19327842
Sequence CTCCACTGACAACTTGGCAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004817457_1004817460 8 Left 1004817457 6:19327820-19327842 CCGATGCCAAGTTGTCAGTGGAG No data
Right 1004817460 6:19327851-19327873 TGCTCTTACAGAGCTAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004817457 Original CRISPR CTCCACTGACAACTTGGCAT CGG (reversed) Intergenic
No off target data available for this crispr