ID: 1004817633

View in Genome Browser
Species Human (GRCh38)
Location 6:19329880-19329902
Sequence CAGTGTGGCTGAAGTAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004817628_1004817633 29 Left 1004817628 6:19329828-19329850 CCTACTTTTGGTAACCACTAGTT No data
Right 1004817633 6:19329880-19329902 CAGTGTGGCTGAAGTAGAGTGGG No data
1004817629_1004817633 15 Left 1004817629 6:19329842-19329864 CCACTAGTTTAAGTCTGCTAAGT No data
Right 1004817633 6:19329880-19329902 CAGTGTGGCTGAAGTAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004817633 Original CRISPR CAGTGTGGCTGAAGTAGAGT GGG Intergenic
No off target data available for this crispr