ID: 1004818266

View in Genome Browser
Species Human (GRCh38)
Location 6:19336128-19336150
Sequence CTAGGCTGCTTGAAGGGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004818257_1004818266 17 Left 1004818257 6:19336088-19336110 CCAGCCTATGTAAGGCTGTGGGT No data
Right 1004818266 6:19336128-19336150 CTAGGCTGCTTGAAGGGTGGTGG No data
1004818258_1004818266 13 Left 1004818258 6:19336092-19336114 CCTATGTAAGGCTGTGGGTCAAA No data
Right 1004818266 6:19336128-19336150 CTAGGCTGCTTGAAGGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004818266 Original CRISPR CTAGGCTGCTTGAAGGGTGG TGG Intergenic
No off target data available for this crispr