ID: 1004824288

View in Genome Browser
Species Human (GRCh38)
Location 6:19403226-19403248
Sequence GACAGCTCTTGGACTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004824288_1004824290 11 Left 1004824288 6:19403226-19403248 CCAGTAACAGTCCAAGAGCTGTC No data
Right 1004824290 6:19403260-19403282 GAGTAGTTATTTGCAGAAGATGG 0: 11
1: 189
2: 190
3: 139
4: 322
1004824288_1004824291 16 Left 1004824288 6:19403226-19403248 CCAGTAACAGTCCAAGAGCTGTC No data
Right 1004824291 6:19403265-19403287 GTTATTTGCAGAAGATGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004824288 Original CRISPR GACAGCTCTTGGACTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr