ID: 1004825270

View in Genome Browser
Species Human (GRCh38)
Location 6:19413094-19413116
Sequence CACATCACCCTGTTTAATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004825270_1004825275 -10 Left 1004825270 6:19413094-19413116 CCAGAATTAAACAGGGTGATGTG No data
Right 1004825275 6:19413107-19413129 GGGTGATGTGAAGGGATGTGGGG No data
1004825270_1004825276 20 Left 1004825270 6:19413094-19413116 CCAGAATTAAACAGGGTGATGTG No data
Right 1004825276 6:19413137-19413159 ATCCTTTGTATGTTCAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004825270 Original CRISPR CACATCACCCTGTTTAATTC TGG (reversed) Intergenic
No off target data available for this crispr