ID: 1004830510

View in Genome Browser
Species Human (GRCh38)
Location 6:19472590-19472612
Sequence CTAATTCCTAATTGCAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004830510_1004830516 6 Left 1004830510 6:19472590-19472612 CCTCCATTGCAATTAGGAATTAG No data
Right 1004830516 6:19472619-19472641 GGAACCAGAAAACACTGGTTTGG No data
1004830510_1004830515 1 Left 1004830510 6:19472590-19472612 CCTCCATTGCAATTAGGAATTAG No data
Right 1004830515 6:19472614-19472636 ATAAGGGAACCAGAAAACACTGG No data
1004830510_1004830518 8 Left 1004830510 6:19472590-19472612 CCTCCATTGCAATTAGGAATTAG No data
Right 1004830518 6:19472621-19472643 AACCAGAAAACACTGGTTTGGGG No data
1004830510_1004830519 9 Left 1004830510 6:19472590-19472612 CCTCCATTGCAATTAGGAATTAG No data
Right 1004830519 6:19472622-19472644 ACCAGAAAACACTGGTTTGGGGG No data
1004830510_1004830517 7 Left 1004830510 6:19472590-19472612 CCTCCATTGCAATTAGGAATTAG No data
Right 1004830517 6:19472620-19472642 GAACCAGAAAACACTGGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004830510 Original CRISPR CTAATTCCTAATTGCAATGG AGG (reversed) Intergenic
No off target data available for this crispr