ID: 1004843520

View in Genome Browser
Species Human (GRCh38)
Location 6:19613738-19613760
Sequence GAGCAGCTCAACCTGGATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004843508_1004843520 30 Left 1004843508 6:19613685-19613707 CCAGCTTGGAGAACAGCCTGAGG 0: 26
1: 16
2: 9
3: 42
4: 660
Right 1004843520 6:19613738-19613760 GAGCAGCTCAACCTGGATCCTGG 0: 1
1: 0
2: 0
3: 16
4: 184
1004843514_1004843520 14 Left 1004843514 6:19613701-19613723 CCTGAGGGAGGTGGAGGCCTGTT No data
Right 1004843520 6:19613738-19613760 GAGCAGCTCAACCTGGATCCTGG 0: 1
1: 0
2: 0
3: 16
4: 184
1004843516_1004843520 -3 Left 1004843516 6:19613718-19613740 CCTGTTATGCCCTGCAGATGGAG 0: 1
1: 6
2: 13
3: 27
4: 127
Right 1004843520 6:19613738-19613760 GAGCAGCTCAACCTGGATCCTGG 0: 1
1: 0
2: 0
3: 16
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004843520 Original CRISPR GAGCAGCTCAACCTGGATCC TGG Intergenic
900931567 1:5741298-5741320 GCCCAGCTCCACCTGGAGCCAGG + Intergenic
901773305 1:11542158-11542180 GACCAGCGCAACCTGGCTCCAGG - Intergenic
902793535 1:18785194-18785216 GAGGAGCTGAGCCTGGAGCCTGG - Intergenic
905257336 1:36693309-36693331 GAGCAGCTCCACCCGGCGCCTGG + Intergenic
914922599 1:151857703-151857725 GAGCAGCTCTAGTTGGATCAAGG + Intergenic
917613041 1:176709240-176709262 GAGCTGCTGAACCTGCATTCTGG + Intronic
918114502 1:181484783-181484805 CAGCCGATCCACCTGGATCCTGG - Intronic
918616561 1:186550958-186550980 GAGAAGCTCAAACTGGATGGAGG - Intergenic
918825583 1:189319590-189319612 GAGCAACTCAAAATGAATCCTGG + Intergenic
918850835 1:189687684-189687706 AATCAGCTCAACATGGATCAAGG - Intergenic
1063081195 10:2769145-2769167 AATCAGCTCAAGATGGATCCAGG + Intergenic
1063381260 10:5587674-5587696 GAGCAGCCCCACCTGGTCCCAGG - Intergenic
1063443749 10:6094940-6094962 GAACAGAACAACCTGGATCTAGG + Intronic
1065660992 10:28004101-28004123 GAGCAGCTCTTCCGGAATCCTGG + Intergenic
1067771759 10:49131640-49131662 GAGCACCTCACCCTGGGGCCGGG + Exonic
1069609198 10:69761334-69761356 GAACAGCTCATCCTGCCTCCTGG - Intergenic
1074815427 10:117138302-117138324 CCGCAGCTCCACCAGGATCCTGG - Intergenic
1075184777 10:120245833-120245855 GAGCAGCCCAAGCTGTATCTGGG - Intergenic
1075728828 10:124624431-124624453 GAGCACCAGAACCTGGAGCCTGG - Intronic
1077333027 11:1991657-1991679 CAGCCCCTCAACCTGGACCCCGG - Intergenic
1077581425 11:3419649-3419671 GTGCAGATCACCCTGCATCCTGG - Intergenic
1078313617 11:10272195-10272217 GAGCAGCTCAAGTTGGAGGCTGG - Intronic
1081783207 11:45727812-45727834 GAGAAGCTTCACCTGGAGCCTGG + Intergenic
1084128562 11:67117803-67117825 GAGCAGCCCAGCCGCGATCCGGG - Intergenic
1084238335 11:67802484-67802506 GTGCAGATCACCCTGCATCCTGG - Intergenic
1084611116 11:70203610-70203632 GAGCAGAACGACCTGGAGCCCGG + Exonic
1084834078 11:71790346-71790368 GTGCAGATCACCCTGCATCCTGG + Intronic
1085367941 11:75969911-75969933 TATCAGCTTATCCTGGATCCTGG + Intronic
1086105147 11:83139394-83139416 GAGAAGGACAACCTGGATTCTGG + Intergenic
1202816010 11_KI270721v1_random:46835-46857 CAGCCCCTCAACCTGGACCCCGG - Intergenic
1092409022 12:8240120-8240142 GTGCAGATCACCCTGCATCCTGG - Intergenic
1094809993 12:34127136-34127158 GACCAGCTCTCCCTGCATCCTGG - Intergenic
1097074643 12:56383820-56383842 GAGCAGCACAGCCTGGACCATGG + Intergenic
1097079046 12:56416127-56416149 GAGCAGCACAGCCCGGATCATGG + Intergenic
1098290314 12:68951738-68951760 GAGCAGAGCAACCAGGAGCCCGG + Intronic
1100761353 12:97810942-97810964 GATCAGTTCAAGCTGGCTCCAGG + Intergenic
1103936394 12:124479804-124479826 CAGCAGGTCAACCTGGAGGCAGG + Intronic
1104349830 12:128035625-128035647 GCTCAGCTCAACCAGGCTCCAGG + Intergenic
1105329541 13:19402810-19402832 GTGCAGCTCCCCCTGGAGCCCGG + Intergenic
1107593175 13:41930493-41930515 GAGCTGCTCAACCTGTATCATGG - Intronic
1109063154 13:57646893-57646915 GTGCTACTCAACCTTGATCCAGG + Intronic
1109887221 13:68558001-68558023 GAGCAGATCTACCTTGCTCCAGG + Intergenic
1110474896 13:75902310-75902332 CAGCAGCTCACCATGGGTCCTGG - Intergenic
1114595226 14:23906325-23906347 GACCAGCTCACCCTCTATCCTGG + Intergenic
1117996301 14:61481300-61481322 CAGCAGCTCCACTTGGAGCCTGG - Intronic
1119325178 14:73755571-73755593 GAGCAGCTCAGCCTGGGGCCTGG + Intronic
1119400147 14:74357597-74357619 GAGCTGCTCAACCGTGAACCTGG + Exonic
1120229691 14:81829419-81829441 GGGCAGCTCCACCTGCAGCCAGG - Intergenic
1121582181 14:95039441-95039463 AAGCAGTTCAACGTGGATGCCGG - Intergenic
1122975735 14:105170008-105170030 TAGCAGCTCCTCCAGGATCCAGG + Intergenic
1124250956 15:28106444-28106466 GAGCCGCTCAGCCTTGCTCCTGG - Intergenic
1124407467 15:29404936-29404958 GACCAGCTCACCCTGGGCCCCGG + Intronic
1125748959 15:42015678-42015700 GAGCAGGTCAAGCTGGCTACAGG + Intronic
1127394226 15:58530493-58530515 ATGCCGCTCAACCTGGATCAAGG + Intronic
1127409044 15:58686453-58686475 GAGCAGCTCAAGTTGGAGGCTGG + Intronic
1131082169 15:89546080-89546102 GAGCAGCTCAGGCTGGACCCAGG + Intergenic
1131096836 15:89660956-89660978 GATCAGCTGAACTTGGCTCCAGG - Intergenic
1132772786 16:1573736-1573758 GAGCAGCTCAGCCTGGCCCCAGG - Intronic
1133005981 16:2882322-2882344 GAGGATCTCGACCTGGACCCTGG + Intergenic
1133047761 16:3098719-3098741 GAGCAGCTTAATTTGGAGCCCGG + Intronic
1133349989 16:5094928-5094950 GTGCAGATCACCCTGCATCCTGG - Intronic
1133502915 16:6382481-6382503 GAGCTGCACAAACTGGCTCCAGG - Intronic
1133569332 16:7025859-7025881 AAGCAGCTCATCCTGGTTGCTGG - Intronic
1136785273 16:32930489-32930511 GAGCAGCTCAACCGTGGGCCTGG + Intergenic
1137771979 16:51023736-51023758 CAACATCTCAACCTGCATCCTGG + Intergenic
1138002760 16:53299045-53299067 TAGCAGCACCACCTGGTTCCAGG - Intronic
1139517978 16:67463041-67463063 AAGCAGGTCAGGCTGGATCCTGG + Intronic
1142898431 17:2997098-2997120 GAACAGCCCAACATGGTTCCAGG + Intronic
1147145584 17:38482634-38482656 GAGCAGCTCAACCGCGGGCCTGG + Exonic
1147459115 17:40557337-40557359 GAGCTGCTGAATCTGGTTCCTGG - Intronic
1151136240 17:71948244-71948266 GAGCAGATTAACATGGGTCCTGG + Intergenic
1152387728 17:79985139-79985161 GAGGTGCTCGTCCTGGATCCTGG + Intronic
1154396546 18:13995881-13995903 GAGCAGCTCAAACAGGTTCCAGG - Intergenic
1156480684 18:37434625-37434647 GAGCAGCTGCACCAGGAACCAGG + Intronic
1156802107 18:41128494-41128516 CTGTAGCCCAACCTGGATCCTGG - Intergenic
1158219983 18:55140491-55140513 GGGCTGCACAACCTGGACCCAGG + Intergenic
1159101333 18:63962499-63962521 AAGCACATCATCCTGGATCCAGG + Intronic
1160450878 18:78965324-78965346 GAGGAGCTGAGCCTGGAGCCAGG - Intergenic
1161824233 19:6551737-6551759 GAGCACCTGAAGCTGCATCCTGG - Intergenic
1161915795 19:7226916-7226938 CAGCAGCTCCACTTGGATGCTGG + Intronic
1163333368 19:16655928-16655950 GTGCAGCACAACCTGTATACAGG + Intronic
1167661421 19:50798104-50798126 GAGCAGCTCCCCCAGGATTCTGG + Exonic
927774117 2:25888762-25888784 GAGCAGCTCTTCCTGGATTCTGG - Intergenic
932480648 2:72037064-72037086 GAGCACTTCAGCCTGGAGCCAGG + Intergenic
933635765 2:84707751-84707773 AAGCAGCTGAAACTGGAGCCAGG + Intronic
933762085 2:85679380-85679402 GTGCATCTCCACCTGGCTCCCGG - Intergenic
937513937 2:122631040-122631062 GAGCAGCTGAACCTGGAGTTTGG + Intergenic
938296551 2:130182623-130182645 CAGCAGGTCCACCAGGATCCTGG - Exonic
938460197 2:131492006-131492028 CAGCAGGTCCACCAGGATCCTGG + Exonic
941189948 2:162369123-162369145 CAGCAGTTCAACCTGGCTCTCGG + Intronic
942202960 2:173590539-173590561 GGGCTGCTTAACCTGGACCCTGG + Intergenic
943088037 2:183338068-183338090 GAGTAGATCACCCTGGATGCAGG + Intergenic
944013260 2:195000352-195000374 GAGTTGCTGAACCTGGAGCCAGG - Intergenic
946148993 2:217751443-217751465 GAGCAGCTGAACTTGGCTCCAGG - Intronic
947483132 2:230521641-230521663 GAGCAGCTGGACCTAGATCAGGG + Intronic
948490062 2:238306933-238306955 GAGAATCACAACCTGGACCCTGG - Intergenic
1171249439 20:23637357-23637379 GCGCAGCTCGAGCTGGCTCCTGG + Intronic
1172590634 20:36115365-36115387 GAGCAGTGCAACCTGGAACTGGG - Intronic
1175470768 20:59225903-59225925 GGGTAGCTCCAGCTGGATCCAGG + Intronic
1178074242 21:29000545-29000567 AAGCAGCTCCACCTGCAACCCGG + Intergenic
1178946334 21:36951015-36951037 AAGCAGCACAACCTGAATCCTGG - Intronic
1179166535 21:38939433-38939455 GGGCCTCTAAACCTGGATCCAGG + Intergenic
1179344882 21:40547065-40547087 GAGCAGCCCAACCTTGGTCATGG + Intronic
1179613344 21:42566256-42566278 GAGCAGCTCAGGCTGGCTCTTGG + Intronic
1180565375 22:16659246-16659268 GTGCAGCTCCCCCTGGAGCCCGG - Intergenic
1180631578 22:17233725-17233747 GAGCAGCTGAAACTGGCCCCTGG - Intergenic
1181944753 22:26507836-26507858 GAGCCGCTGTACCTGGCTCCAGG - Intronic
1182351502 22:29702563-29702585 GAGCAGATTAGCCTGGAGCCCGG + Intergenic
1184399004 22:44262740-44262762 GAGGAGCTGAGCCTGGAACCAGG + Intronic
1184652756 22:45926599-45926621 AGGCACCTCACCCTGGATCCTGG + Intronic
1184764282 22:46563618-46563640 GCTCAGCTCACCCTGGCTCCCGG + Intergenic
949199797 3:1362036-1362058 AAGCAGCTCAACCTTGAGTCAGG + Intronic
950671996 3:14532760-14532782 GTGGGGCTCAACCTGGTTCCGGG + Intronic
951806548 3:26650503-26650525 GAACAGCACACCCTGGATACAGG + Intronic
954433461 3:50483627-50483649 AAGCAGCACAGCCTGGAGCCAGG + Intronic
954788286 3:53111503-53111525 GAACAGCTTAACTGGGATCCAGG - Intronic
956928588 3:74016931-74016953 GAGCAGATCTACCTTGATCCTGG - Intergenic
957054292 3:75432286-75432308 GTGCAGATCACCCTGCATCCTGG - Intergenic
960977968 3:123194789-123194811 CAGCAACTCCACCTGGAGCCTGG + Intronic
961300551 3:125919428-125919450 GTGCAGATCACCCTGCATCCTGG + Intergenic
961887954 3:130108661-130108683 GTGCAGATCACCCTGCATCCTGG - Intronic
962699083 3:137979386-137979408 GAGCTGCTCAGCCTGGATGAGGG + Intergenic
962806900 3:138934160-138934182 GAGCAGCCCAACCAGAATGCTGG + Intergenic
963953580 3:151228793-151228815 AGGCAGCTCAACCTAGTTCCAGG - Intronic
965728646 3:171746283-171746305 GGGCAGCTCAGCCTGCAGCCTGG + Intronic
968705458 4:2075489-2075511 CAGCAGCTCATCATGGATCTGGG + Exonic
968997096 4:3952592-3952614 GTGCAGATCACCCTGCATCCTGG - Intergenic
969303081 4:6308988-6309010 GGGCAGCTCCACCTGCAGCCCGG - Intergenic
969643270 4:8411909-8411931 CAGCAGCCCAGCCTGGATCCTGG + Intronic
969756916 4:9156085-9156107 GTGCAGATCACCCTGCATCCTGG + Intergenic
969816877 4:9693661-9693683 GTGCAGATCACCCTGCATCCTGG + Intergenic
973715634 4:53673184-53673206 GAGCTTCTCATCCTAGATCCCGG + Intronic
976393566 4:84531735-84531757 GAGCAGCTCCACCCGCCTCCTGG + Intergenic
979820222 4:125161496-125161518 CAGCAGCTCAAGCTGTATCTGGG + Intergenic
985492541 5:187979-188001 GAGCAGCTCCCCCAGGATCCAGG + Exonic
985611364 5:891459-891481 GAACAGCACACCCAGGATCCTGG + Intronic
985613101 5:901405-901427 GAGCAGCACCACCCGGTTCCAGG - Exonic
986869634 5:12031277-12031299 CAGCAGCCCAAGCTGTATCCGGG - Intergenic
991068857 5:62454985-62455007 GAGCAGCTGAACCTGGAGATAGG + Intronic
994023417 5:95053999-95054021 GAGCAGCTCAGTGTGGAACCTGG - Intronic
999383812 5:151140326-151140348 AAGCAGCTCAGCCTGGACCAGGG - Intronic
1002417719 5:179129545-179129567 GTCCAGCTCAACCTGGGTCTGGG + Intronic
1002969085 6:1995796-1995818 GAGAAGCTGAACCTGGTTCTGGG + Intronic
1003885104 6:10514512-10514534 GTGCAGGTCAGCCTGGAGCCTGG - Intronic
1003944671 6:11063961-11063983 GAGCAGTTCAACCTGGGTGCAGG - Intergenic
1004843520 6:19613738-19613760 GAGCAGCTCAACCTGGATCCTGG + Intergenic
1005910368 6:30304313-30304335 GAGCAGCTCTACCTTGATTGTGG - Intergenic
1006874141 6:37280633-37280655 GGGCAGCTCATCATGGATCACGG - Intronic
1006904354 6:37523083-37523105 AAGCAGTTCACCCAGGATCCAGG - Intergenic
1006939208 6:37740517-37740539 GACCAGCTCATCATGGGTCCTGG + Intergenic
1008256203 6:49303199-49303221 TAGCAACTCTACCTGGCTCCAGG - Intergenic
1010192476 6:73208696-73208718 GAGCAGCCTAACCAGGCTCCAGG + Intergenic
1010194133 6:73223378-73223400 GAGCAGCCTAACCAGGCTCCAGG + Intronic
1010389185 6:75317858-75317880 GAGCAACTTTACCTTGATCCTGG - Intronic
1019018965 6:168901681-168901703 GTGCAGCCCAGCTTGGATCCAGG - Intergenic
1019595590 7:1856942-1856964 CAGCAGCTCATCCTGTTTCCTGG + Intronic
1020006517 7:4786298-4786320 GAACTGCTCCACCGGGATCCTGG - Exonic
1020080633 7:5284008-5284030 GTGCAGCTCAGACTGGAGCCTGG - Intronic
1022894797 7:34739694-34739716 GAGCAGGTCTACCAGGCTCCAGG + Intronic
1022963789 7:35454757-35454779 GAGCAGCTCCACCTGGAAGCGGG - Intergenic
1024704191 7:51939096-51939118 GGGCAGCTCAGCCTGGCTCTGGG + Intergenic
1025859751 7:65315649-65315671 GAGCTGCAGACCCTGGATCCAGG - Intergenic
1026132479 7:67631795-67631817 GGGCAGCCCAGCCTGGAGCCAGG - Intergenic
1028828261 7:95299349-95299371 GAGCAGCGCATCCTGGATGTGGG + Intronic
1029306150 7:99621523-99621545 GAGCAGCTCAGTCAGGACCCTGG + Exonic
1029661239 7:101963427-101963449 CAGCAGTTCATCCCGGATCCAGG + Intronic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1031983382 7:128145224-128145246 AAGCAGCTAAACCAGGACCCAGG - Intergenic
1034761851 7:153679842-153679864 GAGCAGCTCACACTGCAGCCTGG + Intergenic
1035327762 7:158075909-158075931 GTGCAGCGGAACCTGGAGCCGGG + Intronic
1036380147 8:8231404-8231426 GTGCAGATCACCCTGCATCCTGG + Intergenic
1036849412 8:12191258-12191280 GTGCAGATCACCCTGCATCCTGG - Intronic
1036870774 8:12433531-12433553 GTGCAGATCACCCTGCATCCTGG - Intronic
1037809793 8:22080654-22080676 GAGCAGCAGAAGCTGGGTCCTGG + Intronic
1040627577 8:49168163-49168185 GACCAGCTCACTGTGGATCCTGG - Intergenic
1042381041 8:68114659-68114681 GAGCTCCTCCACCTGGCTCCAGG - Intronic
1042520994 8:69711031-69711053 GAGCTGCTGTACCTGGAGCCAGG - Intronic
1042819933 8:72919234-72919256 GAACAGCTCCACCTGGTTCGTGG + Intronic
1044879105 8:96704183-96704205 GAGCAGCTGAATCAGAATCCGGG - Intronic
1047012247 8:120685040-120685062 GAGCAGGGCTACCTGGAGCCTGG - Intronic
1047187026 8:122642901-122642923 GAGCACCTCAAACAGAATCCAGG + Intergenic
1049284303 8:141766313-141766335 GATCAGCTCAACGTTGATCCTGG + Intergenic
1049311114 8:141934410-141934432 CAGCAGCTCAGCCAGGAGCCCGG + Intergenic
1051120860 9:13750628-13750650 GAGGGGCTCTACCTGGCTCCAGG + Intergenic
1052815932 9:33102606-33102628 GAGAAGTACAGCCTGGATCCAGG - Intergenic
1057271449 9:93653873-93653895 GACCAGCTGGACCTGGATCTGGG + Intronic
1057693732 9:97309403-97309425 GACCAGCTGCACCTGAATCCAGG - Exonic
1059123319 9:111661677-111661699 GAGCAGCTCAAGTTGGAGGCTGG + Exonic
1061376141 9:130225949-130225971 GAGCAGCCCACACTGGACCCTGG - Intronic
1062194997 9:135268030-135268052 GAGCAGCCCAGCCTCAATCCCGG + Intergenic
1193291610 X:79779606-79779628 GAGCAGCTGAACCTGGATTTGGG - Intergenic
1195689256 X:107610374-107610396 GAGCAGCTCACCCTAGAATCAGG + Intergenic
1199924593 X:152449599-152449621 CAGCAACTCAGCCTGGAGCCGGG - Intronic
1200175111 X:154108736-154108758 AACCAGCTGAGCCTGGATCCTGG + Intergenic
1201357313 Y:13111670-13111692 GACCAGCTCTCCCTGCATCCTGG + Intergenic
1201755934 Y:17485109-17485131 GACCAGCTCTCCCTGCATCCTGG - Intergenic
1201845618 Y:18420876-18420898 GACCAGCTCTCCCTGCATCCTGG + Intergenic
1202272545 Y:23085602-23085624 GGGCAGCTCCACCTGCCTCCCGG - Intergenic
1202293481 Y:23335080-23335102 GGGCAGCTCCACCTGCCTCCCGG + Intergenic
1202425542 Y:24719346-24719368 GGGCAGCTCCACCTGCCTCCCGG - Intergenic
1202445247 Y:24950739-24950761 GGGCAGCTCCACCTGCCTCCCGG + Intergenic