ID: 1004843652

View in Genome Browser
Species Human (GRCh38)
Location 6:19614683-19614705
Sequence CTGTTGTTCTTAGGGTAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004843652_1004843655 -1 Left 1004843652 6:19614683-19614705 CCATCTTACCCTAAGAACAACAG No data
Right 1004843655 6:19614705-19614727 GCCCTCATATCTCCATACCCTGG No data
1004843652_1004843657 0 Left 1004843652 6:19614683-19614705 CCATCTTACCCTAAGAACAACAG No data
Right 1004843657 6:19614706-19614728 CCCTCATATCTCCATACCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004843652 Original CRISPR CTGTTGTTCTTAGGGTAAGA TGG (reversed) Intergenic
No off target data available for this crispr