ID: 1004846208

View in Genome Browser
Species Human (GRCh38)
Location 6:19645389-19645411
Sequence CATAGAGCACATGATGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004846208_1004846214 11 Left 1004846208 6:19645389-19645411 CCCAGGCCATCATGTGCTCTATG No data
Right 1004846214 6:19645423-19645445 GAGAGTTCCTGAACCAAAGTTGG No data
1004846208_1004846216 21 Left 1004846208 6:19645389-19645411 CCCAGGCCATCATGTGCTCTATG No data
Right 1004846216 6:19645433-19645455 GAACCAAAGTTGGTCATCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004846208 Original CRISPR CATAGAGCACATGATGGCCT GGG (reversed) Intergenic
No off target data available for this crispr