ID: 1004847157

View in Genome Browser
Species Human (GRCh38)
Location 6:19656876-19656898
Sequence AAGAAACATAATTCTAGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004847157_1004847163 22 Left 1004847157 6:19656876-19656898 CCCGGCCTAGAATTATGTTTCTT No data
Right 1004847163 6:19656921-19656943 TGTTGGTTATAGTTTGCTGTTGG No data
1004847157_1004847161 5 Left 1004847157 6:19656876-19656898 CCCGGCCTAGAATTATGTTTCTT No data
Right 1004847161 6:19656904-19656926 TCAAATGCCTATGGTTTTGTTGG No data
1004847157_1004847160 -4 Left 1004847157 6:19656876-19656898 CCCGGCCTAGAATTATGTTTCTT No data
Right 1004847160 6:19656895-19656917 TCTTGATCTTCAAATGCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004847157 Original CRISPR AAGAAACATAATTCTAGGCC GGG (reversed) Intergenic
No off target data available for this crispr