ID: 1004847160 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:19656895-19656917 |
| Sequence | TCTTGATCTTCAAATGCCTA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1004847157_1004847160 | -4 | Left | 1004847157 | 6:19656876-19656898 | CCCGGCCTAGAATTATGTTTCTT | No data | ||
| Right | 1004847160 | 6:19656895-19656917 | TCTTGATCTTCAAATGCCTATGG | No data | ||||
| 1004847159_1004847160 | -9 | Left | 1004847159 | 6:19656881-19656903 | CCTAGAATTATGTTTCTTGATCT | No data | ||
| Right | 1004847160 | 6:19656895-19656917 | TCTTGATCTTCAAATGCCTATGG | No data | ||||
| 1004847156_1004847160 | 4 | Left | 1004847156 | 6:19656868-19656890 | CCACTTTGCCCGGCCTAGAATTA | No data | ||
| Right | 1004847160 | 6:19656895-19656917 | TCTTGATCTTCAAATGCCTATGG | No data | ||||
| 1004847158_1004847160 | -5 | Left | 1004847158 | 6:19656877-19656899 | CCGGCCTAGAATTATGTTTCTTG | No data | ||
| Right | 1004847160 | 6:19656895-19656917 | TCTTGATCTTCAAATGCCTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1004847160 | Original CRISPR | TCTTGATCTTCAAATGCCTA TGG | Intergenic | ||
| No off target data available for this crispr | |||||