ID: 1004847161

View in Genome Browser
Species Human (GRCh38)
Location 6:19656904-19656926
Sequence TCAAATGCCTATGGTTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004847159_1004847161 0 Left 1004847159 6:19656881-19656903 CCTAGAATTATGTTTCTTGATCT No data
Right 1004847161 6:19656904-19656926 TCAAATGCCTATGGTTTTGTTGG No data
1004847158_1004847161 4 Left 1004847158 6:19656877-19656899 CCGGCCTAGAATTATGTTTCTTG No data
Right 1004847161 6:19656904-19656926 TCAAATGCCTATGGTTTTGTTGG No data
1004847156_1004847161 13 Left 1004847156 6:19656868-19656890 CCACTTTGCCCGGCCTAGAATTA No data
Right 1004847161 6:19656904-19656926 TCAAATGCCTATGGTTTTGTTGG No data
1004847157_1004847161 5 Left 1004847157 6:19656876-19656898 CCCGGCCTAGAATTATGTTTCTT No data
Right 1004847161 6:19656904-19656926 TCAAATGCCTATGGTTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004847161 Original CRISPR TCAAATGCCTATGGTTTTGT TGG Intergenic
No off target data available for this crispr