ID: 1004851205

View in Genome Browser
Species Human (GRCh38)
Location 6:19701684-19701706
Sequence GGTCTGCACCTCAGTAGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004851205_1004851208 14 Left 1004851205 6:19701684-19701706 CCTACTCTACTGAGGTGCAGACC No data
Right 1004851208 6:19701721-19701743 TTTCCAACCTATGAGAACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004851205 Original CRISPR GGTCTGCACCTCAGTAGAGT AGG (reversed) Intergenic
No off target data available for this crispr