ID: 1004851207

View in Genome Browser
Species Human (GRCh38)
Location 6:19701715-19701737
Sequence TTCTCATAGGTTGGAAATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004851207_1004851214 26 Left 1004851207 6:19701715-19701737 CCTGAATTTCCAACCTATGAGAA No data
Right 1004851214 6:19701764-19701786 TGAAGGCACTTAGGATAGACTGG No data
1004851207_1004851211 9 Left 1004851207 6:19701715-19701737 CCTGAATTTCCAACCTATGAGAA No data
Right 1004851211 6:19701747-19701769 CAACAACTGAAGCCATGTGAAGG No data
1004851207_1004851212 17 Left 1004851207 6:19701715-19701737 CCTGAATTTCCAACCTATGAGAA No data
Right 1004851212 6:19701755-19701777 GAAGCCATGTGAAGGCACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004851207 Original CRISPR TTCTCATAGGTTGGAAATTC AGG (reversed) Intergenic
No off target data available for this crispr