ID: 1004851208

View in Genome Browser
Species Human (GRCh38)
Location 6:19701721-19701743
Sequence TTTCCAACCTATGAGAACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004851206_1004851208 -7 Left 1004851206 6:19701705-19701727 CCTCTTCTGACCTGAATTTCCAA No data
Right 1004851208 6:19701721-19701743 TTTCCAACCTATGAGAACATAGG No data
1004851205_1004851208 14 Left 1004851205 6:19701684-19701706 CCTACTCTACTGAGGTGCAGACC No data
Right 1004851208 6:19701721-19701743 TTTCCAACCTATGAGAACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004851208 Original CRISPR TTTCCAACCTATGAGAACAT AGG Intergenic
No off target data available for this crispr