ID: 1004851209

View in Genome Browser
Species Human (GRCh38)
Location 6:19701724-19701746
Sequence AAACCTATGTTCTCATAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004851209_1004851212 8 Left 1004851209 6:19701724-19701746 CCAACCTATGAGAACATAGGTTT No data
Right 1004851212 6:19701755-19701777 GAAGCCATGTGAAGGCACTTAGG No data
1004851209_1004851214 17 Left 1004851209 6:19701724-19701746 CCAACCTATGAGAACATAGGTTT No data
Right 1004851214 6:19701764-19701786 TGAAGGCACTTAGGATAGACTGG No data
1004851209_1004851211 0 Left 1004851209 6:19701724-19701746 CCAACCTATGAGAACATAGGTTT No data
Right 1004851211 6:19701747-19701769 CAACAACTGAAGCCATGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004851209 Original CRISPR AAACCTATGTTCTCATAGGT TGG (reversed) Intergenic
No off target data available for this crispr