ID: 1004851210

View in Genome Browser
Species Human (GRCh38)
Location 6:19701728-19701750
Sequence GTTGAAACCTATGTTCTCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004851210_1004851212 4 Left 1004851210 6:19701728-19701750 CCTATGAGAACATAGGTTTCAAC No data
Right 1004851212 6:19701755-19701777 GAAGCCATGTGAAGGCACTTAGG No data
1004851210_1004851211 -4 Left 1004851210 6:19701728-19701750 CCTATGAGAACATAGGTTTCAAC No data
Right 1004851211 6:19701747-19701769 CAACAACTGAAGCCATGTGAAGG No data
1004851210_1004851214 13 Left 1004851210 6:19701728-19701750 CCTATGAGAACATAGGTTTCAAC No data
Right 1004851214 6:19701764-19701786 TGAAGGCACTTAGGATAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004851210 Original CRISPR GTTGAAACCTATGTTCTCAT AGG (reversed) Intergenic
No off target data available for this crispr