ID: 1004851212

View in Genome Browser
Species Human (GRCh38)
Location 6:19701755-19701777
Sequence GAAGCCATGTGAAGGCACTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004851209_1004851212 8 Left 1004851209 6:19701724-19701746 CCAACCTATGAGAACATAGGTTT No data
Right 1004851212 6:19701755-19701777 GAAGCCATGTGAAGGCACTTAGG No data
1004851207_1004851212 17 Left 1004851207 6:19701715-19701737 CCTGAATTTCCAACCTATGAGAA No data
Right 1004851212 6:19701755-19701777 GAAGCCATGTGAAGGCACTTAGG No data
1004851206_1004851212 27 Left 1004851206 6:19701705-19701727 CCTCTTCTGACCTGAATTTCCAA No data
Right 1004851212 6:19701755-19701777 GAAGCCATGTGAAGGCACTTAGG No data
1004851210_1004851212 4 Left 1004851210 6:19701728-19701750 CCTATGAGAACATAGGTTTCAAC No data
Right 1004851212 6:19701755-19701777 GAAGCCATGTGAAGGCACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004851212 Original CRISPR GAAGCCATGTGAAGGCACTT AGG Intergenic
No off target data available for this crispr