ID: 1004853019

View in Genome Browser
Species Human (GRCh38)
Location 6:19719819-19719841
Sequence CTTTGCACGCTGAAAGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004853019_1004853026 -10 Left 1004853019 6:19719819-19719841 CCTCCCCCTTTCAGCGTGCAAAG No data
Right 1004853026 6:19719832-19719854 GCGTGCAAAGGCAGGCAATGTGG No data
1004853019_1004853028 6 Left 1004853019 6:19719819-19719841 CCTCCCCCTTTCAGCGTGCAAAG No data
Right 1004853028 6:19719848-19719870 AATGTGGGAAAGCGTTCGCCCGG No data
1004853019_1004853027 -9 Left 1004853019 6:19719819-19719841 CCTCCCCCTTTCAGCGTGCAAAG No data
Right 1004853027 6:19719833-19719855 CGTGCAAAGGCAGGCAATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004853019 Original CRISPR CTTTGCACGCTGAAAGGGGG AGG (reversed) Intergenic
No off target data available for this crispr