ID: 1004857050

View in Genome Browser
Species Human (GRCh38)
Location 6:19761930-19761952
Sequence CAGGGGATGAATCCTGTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004857050_1004857057 7 Left 1004857050 6:19761930-19761952 CCTGAAACAGGATTCATCCCCTG No data
Right 1004857057 6:19761960-19761982 AATCATGCTGGATACAAAGACGG No data
1004857050_1004857058 20 Left 1004857050 6:19761930-19761952 CCTGAAACAGGATTCATCCCCTG No data
Right 1004857058 6:19761973-19761995 ACAAAGACGGCCATGAATAATGG No data
1004857050_1004857055 -5 Left 1004857050 6:19761930-19761952 CCTGAAACAGGATTCATCCCCTG No data
Right 1004857055 6:19761948-19761970 CCCTGGGCTTGAAATCATGCTGG No data
1004857050_1004857059 26 Left 1004857050 6:19761930-19761952 CCTGAAACAGGATTCATCCCCTG No data
Right 1004857059 6:19761979-19762001 ACGGCCATGAATAATGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004857050 Original CRISPR CAGGGGATGAATCCTGTTTC AGG (reversed) Intergenic
No off target data available for this crispr