ID: 1004862993

View in Genome Browser
Species Human (GRCh38)
Location 6:19824697-19824719
Sequence TAAAAACCCCAAGATGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004862993_1004862995 16 Left 1004862993 6:19824697-19824719 CCCTGCTCATCTTGGGGTTTTTA No data
Right 1004862995 6:19824736-19824758 AATTCTTCCCCAACCATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004862993 Original CRISPR TAAAAACCCCAAGATGAGCA GGG (reversed) Intergenic
No off target data available for this crispr