ID: 1004864551

View in Genome Browser
Species Human (GRCh38)
Location 6:19838958-19838980
Sequence CAGACTGCACGGGAGGACAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 141}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004864551_1004864559 -1 Left 1004864551 6:19838958-19838980 CCGGTGTCCTCCCGTGCAGTCTG 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1004864559 6:19838980-19839002 GTCACCCACAAAGGGGGACGCGG 0: 1
1: 0
2: 0
3: 6
4: 87
1004864551_1004864565 11 Left 1004864551 6:19838958-19838980 CCGGTGTCCTCCCGTGCAGTCTG 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1004864565 6:19838992-19839014 GGGGGACGCGGGCAGGGCGCCGG 0: 1
1: 0
2: 10
3: 82
4: 738
1004864551_1004864558 -7 Left 1004864551 6:19838958-19838980 CCGGTGTCCTCCCGTGCAGTCTG 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1004864558 6:19838974-19838996 CAGTCTGTCACCCACAAAGGGGG 0: 1
1: 0
2: 2
3: 17
4: 243
1004864551_1004864566 16 Left 1004864551 6:19838958-19838980 CCGGTGTCCTCCCGTGCAGTCTG 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1004864566 6:19838997-19839019 ACGCGGGCAGGGCGCCGGAGTGG 0: 1
1: 0
2: 1
3: 15
4: 185
1004864551_1004864556 -9 Left 1004864551 6:19838958-19838980 CCGGTGTCCTCCCGTGCAGTCTG 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1004864556 6:19838972-19838994 TGCAGTCTGTCACCCACAAAGGG 0: 1
1: 0
2: 0
3: 15
4: 155
1004864551_1004864568 29 Left 1004864551 6:19838958-19838980 CCGGTGTCCTCCCGTGCAGTCTG 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1004864568 6:19839010-19839032 GCCGGAGTGGGTCCCCTCTCCGG 0: 1
1: 0
2: 0
3: 6
4: 95
1004864551_1004864563 4 Left 1004864551 6:19838958-19838980 CCGGTGTCCTCCCGTGCAGTCTG 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1004864563 6:19838985-19839007 CCACAAAGGGGGACGCGGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 86
1004864551_1004864564 5 Left 1004864551 6:19838958-19838980 CCGGTGTCCTCCCGTGCAGTCTG 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1004864564 6:19838986-19839008 CACAAAGGGGGACGCGGGCAGGG 0: 1
1: 0
2: 0
3: 4
4: 98
1004864551_1004864567 17 Left 1004864551 6:19838958-19838980 CCGGTGTCCTCCCGTGCAGTCTG 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1004864567 6:19838998-19839020 CGCGGGCAGGGCGCCGGAGTGGG 0: 1
1: 1
2: 0
3: 14
4: 152
1004864551_1004864557 -8 Left 1004864551 6:19838958-19838980 CCGGTGTCCTCCCGTGCAGTCTG 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1004864557 6:19838973-19838995 GCAGTCTGTCACCCACAAAGGGG No data
1004864551_1004864555 -10 Left 1004864551 6:19838958-19838980 CCGGTGTCCTCCCGTGCAGTCTG 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1004864555 6:19838971-19838993 GTGCAGTCTGTCACCCACAAAGG 0: 1
1: 0
2: 0
3: 17
4: 181
1004864551_1004864560 0 Left 1004864551 6:19838958-19838980 CCGGTGTCCTCCCGTGCAGTCTG 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1004864560 6:19838981-19839003 TCACCCACAAAGGGGGACGCGGG No data
1004864551_1004864570 30 Left 1004864551 6:19838958-19838980 CCGGTGTCCTCCCGTGCAGTCTG 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1004864570 6:19839011-19839033 CCGGAGTGGGTCCCCTCTCCGGG 0: 1
1: 0
2: 0
3: 11
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004864551 Original CRISPR CAGACTGCACGGGAGGACAC CGG (reversed) Intronic
900956840 1:5891518-5891540 CAGACCGCACGGGAGGAGCCCGG - Intronic
901520210 1:9777976-9777998 AAGACGGCAGGGGAGGGCACTGG + Intronic
901646011 1:10717096-10717118 CAGACGGCCAGCGAGGACACTGG + Intronic
905734153 1:40314796-40314818 CAGACTGCAGGGCAGGAGAACGG + Intronic
906204835 1:43981166-43981188 CAGACTGCTGGGGGGGACGCTGG + Exonic
907349012 1:53810906-53810928 CAGACTGCTCCTGAGGACCCGGG + Intronic
908244292 1:62215456-62215478 GAGAATGCAAGGGAGGATACAGG - Intergenic
912938382 1:114023596-114023618 CAGAGTGCACTGGAGTGCACCGG - Intergenic
913159344 1:116131378-116131400 AAGAGAGCAAGGGAGGACACAGG + Intronic
913210130 1:116575532-116575554 CAGACTGCAGGGGAGGCCATGGG - Exonic
916443199 1:164847381-164847403 CAGGCAGCAGGGAAGGACACGGG + Exonic
919517700 1:198547454-198547476 CACAGTGCAGGGGAGGAAACAGG - Intergenic
920448843 1:206041669-206041691 CAGACTGCAGGTGAGGTAACAGG + Intronic
922719079 1:227891172-227891194 CAGACTGCACAGGAGGGGATGGG + Intergenic
1064001445 10:11666755-11666777 CAGCCTGCGGGGCAGGACACTGG + Intergenic
1064484167 10:15767505-15767527 CAGATGTCTCGGGAGGACACGGG - Intergenic
1070951415 10:80434225-80434247 CACACTGCACGTGAGGACCCAGG - Exonic
1072984195 10:100125432-100125454 CAGACAGCAGGGGAGGCCTCAGG + Intergenic
1076463346 10:130661306-130661328 CTATCTGCATGGGAGGACACTGG - Intergenic
1078051050 11:7965120-7965142 CAGGCTGCATGGGAAGACTCAGG + Intronic
1078913828 11:15759091-15759113 CACAATGCCCGGGATGACACAGG + Intergenic
1081852795 11:46285400-46285422 CAGACTGAATGGCAGGACCCTGG + Intronic
1086547261 11:88012360-88012382 CACACTGGAAGGGAAGACACTGG + Intergenic
1086836600 11:91631908-91631930 CCGACTGCATGTGAGGACACAGG + Intergenic
1091285358 11:134405666-134405688 CAATCTGCCCGGGAGGGCACTGG + Intronic
1091463627 12:664813-664835 CAGACAGCAAGGGAGAACACTGG - Intergenic
1092161036 12:6315709-6315731 CAGACTGGAAGGCAGGTCACTGG + Intronic
1092229324 12:6767902-6767924 GAGACAGCACGGGAGCACAGCGG - Intronic
1092373207 12:7934317-7934339 CAGACTCCACGGAAGCCCACTGG + Intronic
1093123946 12:15306521-15306543 CACACTGAAGGGAAGGACACAGG - Intronic
1094623816 12:32104738-32104760 CAGATGCCACGGGAGCACACAGG + Intergenic
1097380989 12:58895516-58895538 CAGAGTGCACGGGTGGAGAGTGG + Intronic
1103507097 12:121449034-121449056 CAGACTGCAGCGGGGGGCACAGG + Intronic
1104968777 12:132521823-132521845 CAGTTTGCACAAGAGGACACGGG + Intronic
1106681320 13:32011505-32011527 CAAAGAGCATGGGAGGACACAGG - Intergenic
1108682878 13:52794383-52794405 CAGACTACAGGAGAGAACACAGG - Intergenic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1117628006 14:57660146-57660168 GAGACTCCACGAGAGGAAACAGG + Intronic
1117873092 14:60221062-60221084 CTTACAGCCCGGGAGGACACTGG - Intergenic
1120543134 14:85776385-85776407 CAGACTGCACTAGAAGGCACTGG + Intergenic
1121088505 14:91164907-91164929 CACCCTGCAGGGAAGGACACAGG - Intronic
1121088665 14:91166311-91166333 CACCCTGCAGGGAAGGACACAGG - Intronic
1121227003 14:92328453-92328475 CAGGCTACACAGAAGGACACCGG - Intronic
1123192364 14:106583445-106583467 CAGACTGCCATGCAGGACACAGG - Intergenic
1124064092 15:26323396-26323418 GAGACTGCAGGAGAGGACAGAGG + Intergenic
1124662370 15:31560765-31560787 CAGGCTGAACTGGAGGACAGTGG - Intronic
1124980413 15:34564832-34564854 CAGACTCCATGGCATGACACAGG - Intronic
1128523521 15:68391166-68391188 CAGAATGGACAGGAGCACACTGG - Intronic
1129320416 15:74771657-74771679 CAGAGTGCAAGGGAAGACAATGG + Intergenic
1129411797 15:75354508-75354530 CAGAGTGCAGGGGAGGAGGCGGG - Intronic
1129849578 15:78785069-78785091 CAGTCTAAACTGGAGGACACAGG + Intronic
1132692373 16:1187359-1187381 CAGACTGCAGCTGAGGTCACAGG - Intronic
1133184366 16:4085056-4085078 GAGGCTGAAAGGGAGGACACTGG + Intronic
1135640844 16:24118615-24118637 CAGACAGCACGAGGGGACAGTGG - Intronic
1136124275 16:28166160-28166182 CAGCCTGCAGGAGAGGACATAGG - Intronic
1139322821 16:66129190-66129212 CAGGCTGCCCGGGAGGCAACAGG + Intergenic
1143733202 17:8892924-8892946 CAAACTGCAGGTCAGGACACAGG + Intronic
1148341013 17:46873408-46873430 CAGTCTGGAAGGGAGAACACAGG + Intronic
1149460675 17:56827738-56827760 CAGCCTCCATGGGAAGACACTGG + Intronic
1149958858 17:61084501-61084523 GAGACTGGACGGGATGACCCTGG - Exonic
1152599195 17:81253009-81253031 CAGCCTGCAAAGGAGGACCCGGG + Intronic
1153047116 18:866343-866365 CACAGTGCATGGGATGACACAGG + Intergenic
1157583656 18:48787705-48787727 CAGACTGCACAGGCAGACAGAGG - Intronic
1161041026 19:2110873-2110895 CAGACTGCCCCGGATGTCACAGG + Exonic
1161415861 19:4145932-4145954 CATTCTGCACAGGAGGACAGAGG - Intergenic
1162641087 19:12010850-12010872 CAGACTGGACTGGAGTACAGTGG + Intergenic
1163790249 19:19302196-19302218 CCCCCTGCAGGGGAGGACACTGG - Intronic
1165933868 19:39377466-39377488 CATCCTGGATGGGAGGACACAGG - Exonic
926560234 2:14408740-14408762 CAGACTGCTCTGCAGGACCCGGG + Intergenic
926740067 2:16103211-16103233 CAGACTGCACGGTGAGACAACGG + Intergenic
927148129 2:20180203-20180225 CAGACTGGACTAGAGGACGCAGG + Intergenic
929905979 2:46046953-46046975 CATCATGCACAGGAGGACACTGG + Intronic
932355943 2:71068570-71068592 CTGGCTGCGCGGGAGGTCACGGG + Exonic
934789255 2:97044439-97044461 CAGCCTGCTCCAGAGGACACTGG + Intergenic
934817223 2:97338102-97338124 CAGCCTGCTCCAGAGGACACTGG - Intergenic
934820473 2:97370382-97370404 CAGCCTGCTCCAGAGGACACTGG + Intergenic
938185705 2:129230129-129230151 GAGACTGCACGGGTGAACTCTGG + Intergenic
939124168 2:138155710-138155732 CAGGCAGCACTGGAGGAAACAGG + Intergenic
948183304 2:236000038-236000060 ACGCCTGCACGTGAGGACACTGG - Intronic
948328813 2:237149224-237149246 CAGACTGCATGGGGAGACTCAGG + Intergenic
948585455 2:239016148-239016170 CAGCCTGCAAAGGAGGACCCTGG + Intergenic
948766938 2:240227233-240227255 CAGCCTGCACTGGAGGCCTCAGG - Intergenic
1171422468 20:25026372-25026394 CAGCCTGGACTGTAGGACACTGG + Intronic
1175032703 20:55971460-55971482 CAGAATGGACTGGAAGACACTGG + Intergenic
1175485155 20:59340502-59340524 CAGACAGCTCCGAAGGACACCGG + Intergenic
1175889642 20:62310515-62310537 GAGGCTGCACGGGAGGCCCCTGG - Exonic
1176084771 20:63290914-63290936 GAGGCTGCACAGGAGGCCACTGG + Intergenic
1176289063 21:5034677-5034699 CAGACTGCAGGGGAGCACTTGGG + Intronic
1179868172 21:44228927-44228949 CAGACTGCAGGGGAGCACTTGGG - Intronic
1179911122 21:44449551-44449573 CAGAATCCAAGGGAGGACCCCGG + Intergenic
1179931690 21:44574968-44574990 CAGGCTGGGCGGGAGCACACGGG - Exonic
1181177713 22:21047285-21047307 CACAGGGCAGGGGAGGACACAGG + Intronic
1183344274 22:37298601-37298623 TAGACTGGACGGGAGGAGAGAGG + Intronic
1185165916 22:49262164-49262186 CAGCCTGTACCGGAGCACACAGG - Intergenic
950097032 3:10336495-10336517 CAGGGTCCCCGGGAGGACACAGG + Intronic
950618963 3:14187130-14187152 CAGACTACTAGGGATGACACAGG - Intronic
951520493 3:23606511-23606533 CAGACTGGAGGGGAGGCCATGGG + Intergenic
960574110 3:119212866-119212888 CAGACTCCACGTGAGAACCCGGG + Intronic
961052348 3:123757577-123757599 CAGACTGCCCAGCAGGACACTGG + Intronic
961459933 3:127043831-127043853 CACCCTGCAGGGGAGGGCACTGG - Intergenic
966885224 3:184373772-184373794 CAGGCTGGACTAGAGGACACGGG - Intronic
968001316 3:195208820-195208842 CAGAGTCCCCGGGAGGTCACTGG + Intronic
968579782 4:1384510-1384532 CAGACTGCACGCAGGGACGCCGG - Intronic
968885503 4:3328966-3328988 CAGTCTGGATGGGAGGTCACAGG + Intronic
972780391 4:42282246-42282268 CAGACTGCACGGGAGCGAAAGGG + Intergenic
983834200 4:172369545-172369567 CAGGCTGCATGGGAGCACCCTGG + Intronic
986094115 5:4538881-4538903 CTCACAGCACGGGAGGACCCTGG + Intergenic
986405951 5:7425053-7425075 CAGGCTTCAAGGGAGGTCACAGG - Intronic
989489324 5:42032298-42032320 TAGACTGCAGGGGAGGACATAGG - Intergenic
992050397 5:72935526-72935548 CTGGCTGCACGGGAGCCCACTGG - Intergenic
993171499 5:84425555-84425577 CAGCCGGCACTGGAGGAAACTGG + Intergenic
998063215 5:139135453-139135475 CAGCCTGCAAGGGAGAACAGTGG + Intronic
1001673078 5:173490731-173490753 CAGAGTGCAGGGCAGGACAAAGG + Intergenic
1002100721 5:176856252-176856274 CAGACTGCAGGTGAGGAAAGGGG + Intronic
1002212841 5:177608789-177608811 CAGCCTGCAGGAGAGGAGACTGG - Intronic
1002316803 5:178349039-178349061 CAGACTGCCCGGCAAGACGCAGG - Intronic
1003176000 6:3752288-3752310 CGGAATGCGCGGGAGGACGCGGG - Intergenic
1004290051 6:14358540-14358562 TAAACTGTGCGGGAGGACACAGG + Intergenic
1004864551 6:19838958-19838980 CAGACTGCACGGGAGGACACCGG - Intronic
1005218149 6:23555540-23555562 CACACAGCTCGGGAGGCCACAGG + Intergenic
1005482873 6:26271347-26271369 CAGACTGCACGCAAGTCCACCGG - Exonic
1006725593 6:36197035-36197057 GGGACTGCACGGGGGGAAACCGG + Intronic
1008106622 6:47445890-47445912 CAGAATGCATGGGAGAAAACAGG + Intergenic
1017398098 6:154027543-154027565 CACACTGAAGGGAAGGACACAGG - Intronic
1019768736 7:2870317-2870339 CGGACAGGACGGGAGGACGCAGG - Intergenic
1021573944 7:22090715-22090737 CAGGCCGCACGGGAGCCCACAGG - Intergenic
1023057655 7:36302710-36302732 GGGACTGCAAGGGAGGACACGGG + Intergenic
1023888087 7:44375017-44375039 CAGACCCCAAGGGAGGGCACTGG - Intergenic
1024634247 7:51274309-51274331 CAGTCAGCACTGGAGGACAAAGG - Intronic
1027541987 7:79478205-79478227 CATACTGCACGTGAGGACCAGGG - Intergenic
1028913028 7:96228996-96229018 CAGGCTGCATGGGAGCCCACGGG - Intronic
1032467045 7:132152667-132152689 CAGCCTTCACGGGAGGATGCTGG - Intronic
1034619509 7:152446094-152446116 CACGCTGCACGGGGGGACACTGG + Intergenic
1035073643 7:156162774-156162796 CAGGCTGCCCCGGGGGACACGGG - Intergenic
1035584320 8:760238-760260 CAGGCAGCAAGGGAGGAGACAGG - Intergenic
1041477172 8:58279311-58279333 CAGACCTCACAGGAGAACACAGG - Intergenic
1047372970 8:124271415-124271437 CAGAGACCACGAGAGGACACAGG + Intergenic
1049247504 8:141570611-141570633 CAGGGTGCACAGGAGGGCACAGG + Intergenic
1050377041 9:4984722-4984744 CAGCCTGCACTGGAGGAGGCCGG - Intergenic
1051887269 9:21906441-21906463 CAGAATGCACGAGAGGAGAGAGG + Intronic
1055468182 9:76585981-76586003 GGGAATGCACGGGAGAACACAGG - Intergenic
1057141763 9:92730750-92730772 GGGACTGCACGGGGGGACTCGGG + Intronic
1057892880 9:98882374-98882396 CAGACTGCAGGGGAGGGAGCAGG + Intergenic
1058717255 9:107733781-107733803 CAGACTGGACCAGAGGCCACTGG + Intergenic
1061696279 9:132376544-132376566 CAGACTGCATGAGAGAGCACAGG + Intronic
1061919836 9:133776662-133776684 CAGGCGGCAGGGGAGGACAAGGG - Intronic
1062040504 9:134402254-134402276 GAGACTTCAGGGGAGGACCCAGG - Intronic
1203774283 EBV:64042-64064 TAGACTTAACGGGAGGAAACAGG + Intergenic
1186444140 X:9611771-9611793 CAGACTGCCCCGAAAGACACAGG - Intronic
1193409095 X:81141240-81141262 CACCCTGCAGGGAAGGACACAGG + Intronic
1200326183 X:155242121-155242143 CAGACTGCACAAAAGGACATAGG + Intergenic