ID: 1004866518

View in Genome Browser
Species Human (GRCh38)
Location 6:19858243-19858265
Sequence CCTGATAATCATTTATTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004866516_1004866518 -4 Left 1004866516 6:19858224-19858246 CCTTCAGTCTTCAGGATCTCCTG No data
Right 1004866518 6:19858243-19858265 CCTGATAATCATTTATTCCATGG No data
1004866515_1004866518 -3 Left 1004866515 6:19858223-19858245 CCCTTCAGTCTTCAGGATCTCCT No data
Right 1004866518 6:19858243-19858265 CCTGATAATCATTTATTCCATGG No data
1004866513_1004866518 7 Left 1004866513 6:19858213-19858235 CCTAATTTCTCCCTTCAGTCTTC No data
Right 1004866518 6:19858243-19858265 CCTGATAATCATTTATTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004866518 Original CRISPR CCTGATAATCATTTATTCCA TGG Intergenic
No off target data available for this crispr