ID: 1004868032

View in Genome Browser
Species Human (GRCh38)
Location 6:19873480-19873502
Sequence AAGAAGACACCCACACATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004868032_1004868034 13 Left 1004868032 6:19873480-19873502 CCCTGATGTGTGGGTGTCTTCTT No data
Right 1004868034 6:19873516-19873538 TAAACAAAGTTGCAGTTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004868032 Original CRISPR AAGAAGACACCCACACATCA GGG (reversed) Intergenic
No off target data available for this crispr