ID: 1004873643

View in Genome Browser
Species Human (GRCh38)
Location 6:19933414-19933436
Sequence AACCTGGTTCTGCTGTTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004873638_1004873643 18 Left 1004873638 6:19933373-19933395 CCTTTTGATATTTCTACAGTTGC No data
Right 1004873643 6:19933414-19933436 AACCTGGTTCTGCTGTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004873643 Original CRISPR AACCTGGTTCTGCTGTTGAC TGG Intergenic
No off target data available for this crispr