ID: 1004878395

View in Genome Browser
Species Human (GRCh38)
Location 6:19979470-19979492
Sequence CTGTCAAAGGTGAAGTAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004878395_1004878399 22 Left 1004878395 6:19979470-19979492 CCTTTCTACTTCACCTTTGACAG No data
Right 1004878399 6:19979515-19979537 GCCACACAGAAAGTACCTTGAGG No data
1004878395_1004878397 -3 Left 1004878395 6:19979470-19979492 CCTTTCTACTTCACCTTTGACAG No data
Right 1004878397 6:19979490-19979512 CAGAGACTTTTTATTATGAGTGG No data
1004878395_1004878398 -2 Left 1004878395 6:19979470-19979492 CCTTTCTACTTCACCTTTGACAG No data
Right 1004878398 6:19979491-19979513 AGAGACTTTTTATTATGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004878395 Original CRISPR CTGTCAAAGGTGAAGTAGAA AGG (reversed) Intergenic
No off target data available for this crispr