ID: 1004880373

View in Genome Browser
Species Human (GRCh38)
Location 6:20001679-20001701
Sequence TCCTCCCCATGTTATAGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004880371_1004880373 -1 Left 1004880371 6:20001657-20001679 CCTACGGGAATGTGAGCAGGATT No data
Right 1004880373 6:20001679-20001701 TCCTCCCCATGTTATAGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004880373 Original CRISPR TCCTCCCCATGTTATAGGTA AGG Intergenic
No off target data available for this crispr