ID: 1004882405

View in Genome Browser
Species Human (GRCh38)
Location 6:20022106-20022128
Sequence CTGAGCTATCACATTTATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004882403_1004882405 -6 Left 1004882403 6:20022089-20022111 CCAATGTGTTTTTGTGCCTGAGC No data
Right 1004882405 6:20022106-20022128 CTGAGCTATCACATTTATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004882405 Original CRISPR CTGAGCTATCACATTTATAG TGG Intergenic
No off target data available for this crispr