ID: 1004884192

View in Genome Browser
Species Human (GRCh38)
Location 6:20036155-20036177
Sequence GATTCAGAGGTCTCTGGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004884184_1004884192 25 Left 1004884184 6:20036107-20036129 CCTGTGGTTGCTCAGAGGCAAAG No data
Right 1004884192 6:20036155-20036177 GATTCAGAGGTCTCTGGGTTGGG No data
1004884183_1004884192 26 Left 1004884183 6:20036106-20036128 CCCTGTGGTTGCTCAGAGGCAAA No data
Right 1004884192 6:20036155-20036177 GATTCAGAGGTCTCTGGGTTGGG No data
1004884186_1004884192 -8 Left 1004884186 6:20036140-20036162 CCACAAAACTCCACAGATTCAGA No data
Right 1004884192 6:20036155-20036177 GATTCAGAGGTCTCTGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004884192 Original CRISPR GATTCAGAGGTCTCTGGGTT GGG Intergenic
No off target data available for this crispr