ID: 1004886806

View in Genome Browser
Species Human (GRCh38)
Location 6:20059080-20059102
Sequence AGAGAGGTTCCCCCATGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004886796_1004886806 25 Left 1004886796 6:20059032-20059054 CCTACTAGTGTCTGGATCCTAGA No data
Right 1004886806 6:20059080-20059102 AGAGAGGTTCCCCCATGGGTGGG No data
1004886801_1004886806 8 Left 1004886801 6:20059049-20059071 CCTAGAAATAGTGTTGGGGGAAA No data
Right 1004886806 6:20059080-20059102 AGAGAGGTTCCCCCATGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004886806 Original CRISPR AGAGAGGTTCCCCCATGGGT GGG Intergenic
No off target data available for this crispr