ID: 1004887013

View in Genome Browser
Species Human (GRCh38)
Location 6:20060868-20060890
Sequence AAGTGCAGGTTGAAGTGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004887011_1004887013 13 Left 1004887011 6:20060832-20060854 CCTAAGGGTGAGAGTACAGGTCA No data
Right 1004887013 6:20060868-20060890 AAGTGCAGGTTGAAGTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004887013 Original CRISPR AAGTGCAGGTTGAAGTGTGA AGG Intergenic
No off target data available for this crispr