ID: 1004888735

View in Genome Browser
Species Human (GRCh38)
Location 6:20076706-20076728
Sequence CCACATAAACTTAAGGTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004888727_1004888735 22 Left 1004888727 6:20076661-20076683 CCAAGTTTCTGCTGTCTTCAGGA 0: 61
1: 68
2: 221
3: 501
4: 1048
Right 1004888735 6:20076706-20076728 CCACATAAACTTAAGGTAAAGGG No data
1004888725_1004888735 26 Left 1004888725 6:20076657-20076679 CCAACCAAGTTTCTGCTGTCTTC 0: 58
1: 180
2: 284
3: 411
4: 560
Right 1004888735 6:20076706-20076728 CCACATAAACTTAAGGTAAAGGG No data
1004888729_1004888735 -7 Left 1004888729 6:20076690-20076712 CCCAAAACATAAGGACCCACATA No data
Right 1004888735 6:20076706-20076728 CCACATAAACTTAAGGTAAAGGG No data
1004888730_1004888735 -8 Left 1004888730 6:20076691-20076713 CCAAAACATAAGGACCCACATAA No data
Right 1004888735 6:20076706-20076728 CCACATAAACTTAAGGTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004888735 Original CRISPR CCACATAAACTTAAGGTAAA GGG Intergenic
No off target data available for this crispr