ID: 1004889849

View in Genome Browser
Species Human (GRCh38)
Location 6:20090049-20090071
Sequence CACCTTTAGTAACAGCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004889849_1004889855 30 Left 1004889849 6:20090049-20090071 CCAAAGTGCTGTTACTAAAGGTG No data
Right 1004889855 6:20090102-20090124 TAAAATGAACTTGAGCAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004889849 Original CRISPR CACCTTTAGTAACAGCACTT TGG (reversed) Intergenic
No off target data available for this crispr