ID: 1004890423

View in Genome Browser
Species Human (GRCh38)
Location 6:20095850-20095872
Sequence TTGATTGAGCACCACCATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004890418_1004890423 2 Left 1004890418 6:20095825-20095847 CCCGAATCCTAGAGGCCCAGAGA No data
Right 1004890423 6:20095850-20095872 TTGATTGAGCACCACCATCAAGG No data
1004890419_1004890423 1 Left 1004890419 6:20095826-20095848 CCGAATCCTAGAGGCCCAGAGAA No data
Right 1004890423 6:20095850-20095872 TTGATTGAGCACCACCATCAAGG No data
1004890415_1004890423 7 Left 1004890415 6:20095820-20095842 CCCCACCCGAATCCTAGAGGCCC No data
Right 1004890423 6:20095850-20095872 TTGATTGAGCACCACCATCAAGG No data
1004890413_1004890423 24 Left 1004890413 6:20095803-20095825 CCAGCATGCTGGACTTACCCCAC No data
Right 1004890423 6:20095850-20095872 TTGATTGAGCACCACCATCAAGG No data
1004890416_1004890423 6 Left 1004890416 6:20095821-20095843 CCCACCCGAATCCTAGAGGCCCA No data
Right 1004890423 6:20095850-20095872 TTGATTGAGCACCACCATCAAGG No data
1004890420_1004890423 -5 Left 1004890420 6:20095832-20095854 CCTAGAGGCCCAGAGAACTTGAT No data
Right 1004890423 6:20095850-20095872 TTGATTGAGCACCACCATCAAGG No data
1004890417_1004890423 5 Left 1004890417 6:20095822-20095844 CCACCCGAATCCTAGAGGCCCAG No data
Right 1004890423 6:20095850-20095872 TTGATTGAGCACCACCATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004890423 Original CRISPR TTGATTGAGCACCACCATCA AGG Intergenic
No off target data available for this crispr