ID: 1004891859

View in Genome Browser
Species Human (GRCh38)
Location 6:20108588-20108610
Sequence AATTCCCTATAGCCGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 55}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004891859_1004891863 -5 Left 1004891859 6:20108588-20108610 CCCTCCATCGGCTATAGGGAATT 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1004891863 6:20108606-20108628 GAATTCCCAACTTAGGAAGAAGG 0: 1
1: 0
2: 2
3: 9
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004891859 Original CRISPR AATTCCCTATAGCCGATGGA GGG (reversed) Intronic
900671830 1:3859118-3859140 AATTCCCAAGAGCAGAGGGAGGG + Intronic
905098074 1:35492735-35492757 AATTCCCTACAGCTGATGAAAGG + Intronic
914979815 1:152404214-152404236 AAGTCCCTACAGGAGATGGAGGG + Intergenic
920183593 1:204147292-204147314 AACTCCCTATAGCAGAGGAAGGG - Intronic
921207952 1:212865466-212865488 AAATCCCTATTGCAAATGGAAGG - Intronic
922652301 1:227351384-227351406 TATTCCCATTAGCTGATGGAAGG + Intergenic
1066792567 10:39081978-39082000 AATTCCATGTGGCAGATGGATGG - Intergenic
1084593310 11:70102881-70102903 AATTCCCTTTAGCAGAAGGTGGG - Intronic
1088132796 11:106514573-106514595 TATTCACAATAGCCAATGGATGG + Intergenic
1088816086 11:113422010-113422032 AACCCCCTATAGCCCATGTATGG + Intronic
1094109167 12:26842931-26842953 AATTCGCTACAGTTGATGGAAGG - Intergenic
1098529797 12:71528849-71528871 AATTCTCTGTTGCCTATGGAGGG + Intronic
1100484731 12:95014350-95014372 AATTCCCTGTATCCAAGGGAGGG - Intergenic
1108455204 13:50606071-50606093 AATTCCCTGTATTCGAAGGAGGG + Intronic
1109783522 13:67144043-67144065 AATTCCCTTTAGTCCAAGGAAGG + Intronic
1111547728 13:89765101-89765123 AAGTCCCTATAACAGATGAATGG + Intergenic
1114184635 14:20391177-20391199 TATTCCCTCTAACCAATGGAAGG - Intronic
1118038295 14:61891926-61891948 AATTCCCTACAGCAAATGGCAGG + Intergenic
1126120428 15:45246694-45246716 GATTTCCTATTGCTGATGGAGGG - Intergenic
1129794293 15:78364257-78364279 AACTCCATATAGAAGATGGATGG - Intergenic
1137339037 16:47581299-47581321 AACTCCCTCTAGAGGATGGATGG + Intronic
1141762171 16:86035832-86035854 ACTTCCCTAGAGCCTCTGGAGGG + Intergenic
1146511005 17:33448617-33448639 TTTTCCCTATAGCCCCTGGAGGG + Intronic
1146914203 17:36667751-36667773 AGATCCCCATAGCCGAAGGAAGG + Intergenic
1148294063 17:46484487-46484509 AATTTCCTATAGCTGAAGAAAGG - Intergenic
1148316246 17:46702190-46702212 AATTTCCTATAGCTGAAGAAAGG - Intronic
1158781770 18:60661372-60661394 ATTTCTCCATAGCCCATGGATGG + Intergenic
1159283435 18:66317357-66317379 AATTCTCTACAGCTGATAGATGG - Intergenic
1159821218 18:73147114-73147136 ATTTCACTATAGCTCATGGATGG + Intergenic
937506464 2:122543123-122543145 AAATCCCTATAGCAGAGGCAAGG - Intergenic
941471295 2:165891126-165891148 AATTCCCTATAGAGGCTGTATGG + Intronic
1169019619 20:2319764-2319786 CATTCCCTACAGCTGATGGTTGG + Intronic
1177894932 21:26846203-26846225 AATTCCCTAGAGCATAAGGAGGG + Intergenic
1184431733 22:44445066-44445088 AATTCACTGTAACAGATGGAAGG - Intergenic
951414068 3:22401657-22401679 AATTCCTGATAGACAATGGATGG + Intergenic
959442936 3:106401193-106401215 AATTCCCTATAGTCAAAAGAAGG + Intergenic
962036403 3:131656168-131656190 AACTCCCTATGGCTGGTGGAGGG + Intronic
963772315 3:149400169-149400191 TATTCCCAATAGCCAATGTATGG + Intergenic
966278291 3:178201765-178201787 TATTCCCTAGAGCCTTTGGATGG - Intergenic
970522505 4:16899742-16899764 AAATCCCAACAGCCCATGGAAGG + Intergenic
972799531 4:42460354-42460376 ATTTCCATATAGCAAATGGATGG + Intronic
973546032 4:51982883-51982905 AAAAACCTATAGCCAATGGATGG + Intergenic
983895244 4:173074491-173074513 TCTTCCCTAAAGCAGATGGATGG + Intergenic
987674873 5:21062212-21062234 AATTCTCTATATCCCTTGGATGG - Intergenic
989162102 5:38401216-38401238 AATTTCCTAGAGCAGATGGAGGG + Intronic
995237372 5:109844638-109844660 ATTTCCCTATAGCTTTTGGAGGG - Intronic
999880441 5:155857387-155857409 AATTCCCATTAGCAGATGAATGG + Intergenic
1001550946 5:172602016-172602038 AATTCCCTATATTCCATGGAAGG - Intergenic
1003109746 6:3243563-3243585 AATTCCCTATAGTAGTTGGAGGG - Intronic
1003247961 6:4400220-4400242 AATTCACTAGAGCCAATGCAAGG + Intergenic
1004891859 6:20108588-20108610 AATTCCCTATAGCCGATGGAGGG - Intronic
1014632673 6:123805078-123805100 AATTCCCTAAGGGCAATGGAAGG + Intronic
1021853536 7:24831875-24831897 AATTCTCTAGAGCAGCTGGATGG + Intronic
1034816217 7:154174040-154174062 AATACCCTATAGCCAAAGGATGG - Intronic
1044324569 8:90845050-90845072 AATTCCCTGTTGCTAATGGAAGG + Intronic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1052856446 9:33409786-33409808 TATTCCCAATAGCCGAAAGAGGG - Intergenic
1186199313 X:7140298-7140320 ATTCCCTTATAGCCGATGGTAGG + Intronic
1187563490 X:20425062-20425084 ATTTCCCTAGAGCCCTTGGAGGG - Intergenic
1187757099 X:22539964-22539986 AATTCCTTATAGCTGTAGGATGG - Intergenic
1191006674 X:55717532-55717554 AATTCTCCATAGCGGATGGGTGG + Intergenic