ID: 1004901146

View in Genome Browser
Species Human (GRCh38)
Location 6:20195318-20195340
Sequence CTGCTGTCAGTGGCCAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 305}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004901146_1004901151 24 Left 1004901146 6:20195318-20195340 CCAGCTTTGGCCACTGACAGCAG 0: 1
1: 0
2: 2
3: 32
4: 305
Right 1004901151 6:20195365-20195387 TGACATACTCTTATGACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004901146 Original CRISPR CTGCTGTCAGTGGCCAAAGC TGG (reversed) Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900547782 1:3238065-3238087 CTTCTCTCATTGGCCAAAGAGGG + Intronic
901622288 1:10598218-10598240 CTGCTGAGAGTGGGAAAAGCAGG - Intronic
902983868 1:20143611-20143633 CTCCTGTCAGGGGCCAAATGAGG + Intronic
904309693 1:29620852-29620874 CTGGTGACAGGGGCCAGAGCGGG + Intergenic
904979331 1:34483787-34483809 CTTCAGTCAGTGGTAAAAGCAGG + Intergenic
905628208 1:39502641-39502663 GAGCTGCCAGTGGCCAAAACTGG + Intronic
906529536 1:46515589-46515611 CTGCTTTCAGTACCCAAGGCTGG - Intergenic
906841879 1:49147925-49147947 ATCCTGTCTGTGTCCAAAGCAGG + Intronic
907306960 1:53518784-53518806 GTGAAGTCAGTGGCCCAAGCAGG + Intronic
908357892 1:63340197-63340219 GTGCTGTGAGAGGCCAAGGCAGG + Intergenic
908914013 1:69105021-69105043 GTGCTGTCAGTGGACAGAGAGGG + Intergenic
909073702 1:71027407-71027429 GTGCTTTGAGAGGCCAAAGCAGG - Intronic
913375192 1:118143899-118143921 CTGCAGGCAGTGGGCAAGGCAGG - Intronic
913545114 1:119860370-119860392 CTGCTGTCAGTGAGAACAGCAGG - Intergenic
916430199 1:164720662-164720684 CTTCTGCCAGTGACCAAACCGGG + Intronic
916610899 1:166390523-166390545 GTGCTGGCACTAGCCAAAGCTGG + Intergenic
918652201 1:186979055-186979077 CTGCTGTGAGTGGGTCAAGCAGG + Intronic
920063904 1:203250655-203250677 GAGCTCTCGGTGGCCAAAGCTGG - Intronic
920737070 1:208542543-208542565 CTGCTGTCCATATCCAAAGCAGG - Intergenic
921157573 1:212450263-212450285 CTGCTGTGAGGGGCTGAAGCTGG + Intergenic
923014968 1:230119844-230119866 CAGCTTTCACTGACCAAAGCTGG - Intronic
1063514412 10:6680812-6680834 CTGCTTTCAGTCTCCAAAGGAGG + Intergenic
1063868841 10:10396719-10396741 CCGCTGTCAGTTCCAAAAGCTGG - Intergenic
1064135698 10:12748675-12748697 CTGCTGACAGTGACCATAGCAGG + Intronic
1064373450 10:14774482-14774504 GTGCAGCCTGTGGCCAAAGCAGG - Exonic
1064376791 10:14803693-14803715 AGGCTGTCACTGGCCAAATCTGG + Intergenic
1064553182 10:16522186-16522208 CTGCTGGCAGTGGGGAAATCGGG - Intergenic
1064951239 10:20853336-20853358 CTTCTTTCAGTGGCCAAACTTGG - Intronic
1065249585 10:23797100-23797122 CAGCTCTGAGAGGCCAAAGCAGG - Intronic
1065296680 10:24282583-24282605 GGGCTCCCAGTGGCCAAAGCTGG - Intronic
1065829391 10:29600540-29600562 GTGCTGTCAGTGGCAAAATCAGG + Intronic
1067267021 10:44755335-44755357 GTACTGTCAGAGGCCAAGGCAGG - Intergenic
1067478815 10:46582604-46582626 GTGCTGTCAGAGGCCAGCGCGGG + Intronic
1067487709 10:46667181-46667203 GAGCTCCCAGTGGCCAAAGCTGG + Intergenic
1067607097 10:47674823-47674845 GAGCTCCCAGTGGCCAAAGCTGG - Intergenic
1067615923 10:47759197-47759219 GTGCTGTCAGAGGCCAGCGCGGG - Intergenic
1069567748 10:69474823-69474845 CTGCTGGCAGTGGCCTGAGCTGG + Intronic
1070775154 10:79105337-79105359 CAGCAGTCAGTGGCCAAGCCCGG - Intronic
1071547852 10:86541980-86542002 GAGCTCCCAGTGGCCAAAGCAGG + Intergenic
1071622656 10:87136192-87136214 GAGCTCCCAGTGGCCAAAGCTGG - Intronic
1072582012 10:96747881-96747903 CTGCTGTCAGTGGACCAGCCTGG + Intergenic
1073501150 10:103938301-103938323 CAGCTCCCAGTGGCCAAAGCTGG - Intergenic
1074047882 10:109855444-109855466 GAGCCCTCAGTGGCCAAAGCTGG + Intergenic
1074397625 10:113111543-113111565 GTCCTTTCAGAGGCCAAAGCAGG + Intronic
1074490722 10:113937110-113937132 CTGCCATCAGTGGGCAAGGCTGG - Intergenic
1075630386 10:123997150-123997172 CGGCTGTCAGAGGCCAGGGCTGG + Intergenic
1077109418 11:855532-855554 CTGAGGCCAGTGTCCAAAGCAGG - Intronic
1077381316 11:2240089-2240111 GAGCTTCCAGTGGCCAAAGCTGG + Intergenic
1077522154 11:3042873-3042895 CTGCTGGCCGTGGCCACAGGGGG - Intronic
1077970758 11:7187619-7187641 GGCCTGTCAGTGGCCAAGGCTGG - Intergenic
1078574297 11:12485524-12485546 GAGCTCCCAGTGGCCAAAGCTGG + Intronic
1078731597 11:13979940-13979962 ATGCTGTCAGGGGACAGAGCTGG - Intronic
1079903326 11:26215382-26215404 CAGCTCCCAGTGGCCAAAGCTGG - Intergenic
1080322945 11:31035978-31036000 AATCTCTCAGTGGCCAAAGCTGG - Intronic
1080750180 11:35143741-35143763 CTGATATCTGTGGCCAAACCTGG - Intronic
1080816674 11:35764439-35764461 CTGGTGTCAGAGGCTATAGCAGG - Intronic
1083079432 11:60074716-60074738 CAGCTCCCAATGGCCAAAGCTGG - Intergenic
1084400111 11:68938621-68938643 GTTCTGTCAGTGGCCTAATCTGG + Intronic
1084438255 11:69156476-69156498 CGGCTGTGAGAGGCCAGAGCTGG + Intergenic
1084571260 11:69961273-69961295 CTGCTGGGAGGGGCCAAAGACGG + Intergenic
1084911350 11:72391977-72391999 CTGCTTTCAGTGGCCAGAGGGGG + Intronic
1085299261 11:75448986-75449008 CTGCTCTCATTGGCCACCGCGGG - Exonic
1085385067 11:76152919-76152941 TTGCTGCCAGCGGCCAAAACAGG - Intergenic
1085992662 11:81869105-81869127 GTGTTCTCAATGGCCAAAGCTGG - Intergenic
1086539211 11:87887337-87887359 CTTCCTTCAGTGGCCAAAACAGG + Intergenic
1087117413 11:94540618-94540640 CTGCTGTCATTGGCCAAACCTGG - Intergenic
1087841380 11:102924023-102924045 CTGGGGTCAGTGGCTAATGCCGG - Intergenic
1087902517 11:103657729-103657751 GTACTCCCAGTGGCCAAAGCTGG + Intergenic
1088391867 11:109323691-109323713 GAGCTCTCAGTGTCCAAAGCTGG - Intergenic
1088716569 11:112554576-112554598 CTGCCCTCAGTCTCCAAAGCAGG - Intergenic
1091248020 11:134116503-134116525 GAGCTTCCAGTGGCCAAAGCTGG - Intronic
1091750131 12:3017285-3017307 TCGCTGCCAGTGGCCAGAGCTGG - Intronic
1092771128 12:11897720-11897742 CTGCTTTCAGTGACCAAGACTGG - Intergenic
1093186681 12:16028298-16028320 GAGCTCCCAGTGGCCAAAGCTGG + Intronic
1093336672 12:17912908-17912930 CTGCTGTCCGTGGCCCAGGTAGG - Intergenic
1093590594 12:20897180-20897202 CTGCTGTCCTTTGTCAAAGCAGG + Intronic
1094498712 12:31005351-31005373 CTGCTGTCCGTGGCCACTGTGGG - Intergenic
1096737819 12:53669669-53669691 GTGCTGCCAGTGGCAAAAGCTGG + Intronic
1097502154 12:60418133-60418155 CAGCTGTCAGTGGCCCAAACTGG - Intergenic
1098722652 12:73922385-73922407 GTGCTTTGAGAGGCCAAAGCAGG - Intergenic
1102257623 12:111425325-111425347 CTGGTCTCAGTGGCCACTGCAGG + Intronic
1102452360 12:113051422-113051444 CTGTTCACAGTGGTCAAAGCTGG - Intergenic
1102551774 12:113696576-113696598 CTGCTGGCTATGGCCAAAGATGG + Intergenic
1103078963 12:118008302-118008324 ATGCTTTGAGAGGCCAAAGCGGG + Intergenic
1103583527 12:121934179-121934201 TTGCTGATAGTGGCCAAGGCTGG + Intronic
1104737698 12:131148027-131148049 AAGCTCTCAATGGCCAAAGCTGG - Intergenic
1104754730 12:131261937-131261959 TGGGTGTCAGTGGCCAAAACAGG - Intergenic
1105759437 13:23499991-23500013 ATGCTGCCAATGGCCAGAGCTGG + Intergenic
1106465988 13:30015108-30015130 CTGCTGTCAGCAGGCGAAGCAGG - Intergenic
1106870283 13:34011836-34011858 CTCCTGTCAGTGTCCAAAAGAGG + Intergenic
1107426346 13:40296880-40296902 CTGCTGACAGGGGGCATAGCTGG + Intergenic
1110555872 13:76858353-76858375 CAGATCTCATTGGCCAAAGCTGG - Intergenic
1110806292 13:79757875-79757897 GGGCTGGCAGAGGCCAAAGCAGG + Intergenic
1112008685 13:95276165-95276187 CTGCTTTGAGGGGCCAAGGCAGG + Intronic
1112630463 13:101156108-101156130 GTGCCCCCAGTGGCCAAAGCAGG - Intronic
1115258364 14:31426884-31426906 CTGCTGTCCCTGGCCACTGCAGG - Intronic
1117972322 14:61264447-61264469 TTGCTGAAAGTGGCCAAATCAGG - Intronic
1118489833 14:66248148-66248170 ATGCTGTCAGTGCAGAAAGCAGG + Intergenic
1120961096 14:90125682-90125704 GCACTCTCAGTGGCCAAAGCTGG + Intronic
1121334807 14:93070715-93070737 CTGCAGACAGTGGCCAAGGTAGG - Intronic
1121435165 14:93914503-93914525 CTGCTGGCTGTGGCCTGAGCTGG - Intergenic
1124150502 15:27173622-27173644 GTGCTTTGAGAGGCCAAAGCAGG + Intronic
1124227984 15:27912477-27912499 CTGCTCCCAGTGGTCAAAACTGG + Intronic
1124467965 15:29956631-29956653 GTACTTTCAGTGGCCAAGGCAGG + Intronic
1125099973 15:35901244-35901266 CAGCTCCCAGTGGTCAAAGCTGG - Intergenic
1125903406 15:43369766-43369788 TTGCTGTCGGTGGCTAAGGCCGG - Exonic
1127059125 15:55164054-55164076 TGGCTGTCAGTGGCCTCAGCGGG + Intergenic
1127360934 15:58244683-58244705 ATGCAGTCAGTGGCCAGAGAAGG - Intronic
1127409449 15:58691278-58691300 CTGCTGTCAGTTACCAAGGAGGG - Intronic
1127856741 15:62959880-62959902 CTGCTGTAAGTTCCCAAACCTGG - Intergenic
1127939308 15:63677893-63677915 CTGCTGGGAGTGGTCAAAGAGGG - Exonic
1128161598 15:65426267-65426289 CTGCTCCCAGTGCCCAGAGCAGG - Intergenic
1128674004 15:69595649-69595671 ATGCTGCAAGTGGCCAAGGCTGG + Intergenic
1128809676 15:70561789-70561811 GTGCTGCCAGGGGACAAAGCTGG - Intergenic
1132681136 16:1142205-1142227 CTGCTGTCAGTGGCAGGAGAGGG + Intergenic
1133066940 16:3214739-3214761 CTGGTCCCAGTGGCCAAAGGAGG + Intergenic
1133968027 16:10545880-10545902 CTGCTGTGAGTGGCCTGGGCAGG - Intronic
1134112915 16:11527121-11527143 CTGCCATCAGCGGCCAGAGCAGG + Intergenic
1134510555 16:14843291-14843313 CTGCTCTTAGTGGCCAAAATCGG - Intronic
1134698195 16:16241780-16241802 CTGCTCTTAGTGGCCAAAATCGG - Intronic
1134973643 16:18552897-18552919 CTGCTCTTAGTGGCCAAAATCGG + Intronic
1136266714 16:29125520-29125542 GAGCTGCCAATGGCCAAAGCTGG - Intergenic
1138578324 16:57923041-57923063 CTGCTGGCCGTGGACACAGCTGG + Intronic
1139034486 16:62927007-62927029 CTGCTTTTAGGGGGCAAAGCAGG + Intergenic
1141056447 16:80819627-80819649 ATGCTGCCAGTGGCCGAAGCTGG + Intergenic
1141074486 16:80991064-80991086 AGACTCTCAGTGGCCAAAGCTGG + Intronic
1141301802 16:82822914-82822936 TTGCAGTCAGTGGCCGAGGCTGG + Intronic
1141425594 16:83942551-83942573 CTCCTGTCACTAGGCAAAGCAGG - Intronic
1141889719 16:86918465-86918487 CGGCTGTTAGGGGCCAAACCAGG + Intergenic
1141992840 16:87620336-87620358 CTGGTGTCATGGGCCAGAGCGGG + Intronic
1142055565 16:87993498-87993520 GAGCTGCCAATGGCCAAAGCCGG - Intronic
1143178147 17:4968246-4968268 CTGAGGTCAGTGGCCAGAGTCGG + Exonic
1143564582 17:7713921-7713943 CTGCTGGCAGAGTCCAGAGCAGG + Intergenic
1146564515 17:33900886-33900908 CTGCTGTCTTTAGCCAAGGCTGG - Intronic
1146934286 17:36801978-36802000 GTGCTCCCAGTGGCCAAGGCTGG - Intergenic
1147773785 17:42886184-42886206 GTGCTTTCAGAGGCCAAGGCAGG - Intergenic
1147933901 17:44000448-44000470 TAGCTGTCAATGGCCACAGCTGG + Intronic
1149774133 17:59344035-59344057 CTGCTTCCAGTTGCCCAAGCAGG - Intronic
1151420028 17:73991043-73991065 CTAATGTTAGTGGCCTAAGCAGG + Intergenic
1151427405 17:74040135-74040157 CTGAGGTCAGTTGCCACAGCAGG - Intergenic
1151439826 17:74120921-74120943 AGGCTGTGAGAGGCCAAAGCTGG + Intergenic
1152199903 17:78939332-78939354 TTGGTGTCAGTGGCCACAACTGG - Intergenic
1152350577 17:79781969-79781991 CTGCTGCCAGGGGCCCCAGCCGG + Intronic
1153522744 18:5967746-5967768 CTGCTGGCAGTGGGCAGAGTGGG + Intronic
1154977153 18:21470036-21470058 GTGCTTTGAGAGGCCAAAGCTGG + Intronic
1155114829 18:22753872-22753894 CTGCTTTCAGTGACCAAAGGAGG - Intergenic
1156013507 18:32521755-32521777 GGGCTCCCAGTGGCCAAAGCTGG - Intergenic
1156150569 18:34236818-34236840 CAGCTCCCAGTGGCCAAACCTGG - Intergenic
1159539567 18:69757988-69758010 CAGCTGTCACTGGCCACAGTGGG + Intronic
1161383198 19:3977335-3977357 CTTCTGGCAGTGTCCAGAGCAGG - Exonic
1161682059 19:5685012-5685034 CTGCTGACAGGGGCCAACGCTGG + Exonic
1162309289 19:9895880-9895902 CAGCTTTCAGAGGCCAAGGCGGG - Intronic
1162915074 19:13870325-13870347 CTGCTTTGGGAGGCCAAAGCAGG - Intronic
1163406942 19:17128666-17128688 CTGCTGTCAGTGTCCCCAGGTGG + Intronic
1164028230 19:21373496-21373518 CTGGTGTTTGTGGCAAAAGCAGG + Intronic
1164259546 19:23557629-23557651 TTGGTGTCAGTGTCCAGAGCAGG - Intronic
1164855540 19:31517858-31517880 CTGCAGTCAGTCCTCAAAGCCGG - Intergenic
1165539005 19:36475327-36475349 TTGATGTCAGTGGCCAAACGTGG - Intronic
1166902493 19:46076337-46076359 GAGCTCCCAGTGGCCAAAGCTGG - Intronic
1167505748 19:49870186-49870208 CTGCTGGCAGTGGGCATCGCAGG - Intronic
925015225 2:518918-518940 CTGGGGTCAGTGGGCAAAGAAGG - Intergenic
925660859 2:6200707-6200729 GAGCTTCCAGTGGCCAAAGCTGG - Intergenic
925692530 2:6539662-6539684 CTGCTGTCACTGCCCAGAGTTGG + Intergenic
926831934 2:16972683-16972705 TTTCTGGCAGAGGCCAAAGCTGG + Intergenic
928607131 2:32953368-32953390 CAGCTGCCAATGGCCATAGCAGG - Intronic
928923215 2:36548051-36548073 CAGTTGCCAGTGTCCAAAGCTGG + Intronic
929552617 2:42904038-42904060 TTGCTGTCTGTGAACAAAGCAGG + Intergenic
930165918 2:48203834-48203856 CAGCTCTGAGAGGCCAAAGCAGG + Intergenic
931082584 2:58792135-58792157 CTGCTGTCATATGCCAGAGCTGG + Intergenic
933164213 2:79057173-79057195 GAGCTTTCAATGGCCAAAGCTGG + Intergenic
933878311 2:86642617-86642639 GTGCTCCCAGTGGCCAAATCTGG - Intronic
935314362 2:101816843-101816865 TTGGTTTCAGTGGCCCAAGCAGG + Intronic
935568911 2:104638472-104638494 CCGCAGTCAGTAGCCTAAGCAGG + Intergenic
936498610 2:113047105-113047127 GTGCTTCCAATGGCCAAAGCTGG - Intronic
937599806 2:123717827-123717849 CTGATGTCACTCCCCAAAGCTGG + Intergenic
939796600 2:146653285-146653307 CTGCTTTCAGGTACCAAAGCAGG + Intergenic
940053519 2:149489640-149489662 CTCATTTCATTGGCCAAAGCAGG + Intergenic
942137188 2:172937895-172937917 GAGCTCCCAGTGGCCAAAGCTGG - Intronic
944227576 2:197363636-197363658 GTGCTTTGAGAGGCCAAAGCAGG + Intergenic
944626490 2:201574784-201574806 TTGCTGCCAGTGGCCAAAACAGG - Intronic
945418150 2:209600439-209600461 CTGCTGTCAGTCCCCCCAGCTGG + Intronic
945531525 2:210959600-210959622 ATGTTGTATGTGGCCAAAGCGGG - Intergenic
945554277 2:211260227-211260249 CTGCTTGAAATGGCCAAAGCTGG + Intergenic
945727550 2:213491556-213491578 CTGATGGGAGTGGCCAATGCTGG + Intronic
947326205 2:228980722-228980744 CTGCAGTCTGTGGACAGAGCTGG + Intronic
1168894096 20:1312142-1312164 GTGCTTTGAGAGGCCAAAGCAGG - Intronic
1169196793 20:3687498-3687520 CTTCTTTCAGGGGCCAAATCTGG + Exonic
1172554812 20:35831685-35831707 GTGCTTTCAGAGGCCAAGGCAGG - Intronic
1172609128 20:36236435-36236457 CTCCAGTCAGACGCCAAAGCTGG + Intergenic
1173083645 20:39893552-39893574 GTGCTGTCAGAGGCCAAAGTGGG - Intergenic
1173497204 20:43528411-43528433 CTGCTGACAGTGGCCTGAGCGGG + Intronic
1173624181 20:44459527-44459549 CTACTGTCGGTGGCCAAGGGTGG - Intronic
1174402383 20:50282975-50282997 CTGGTGGCCGTGGCCGAAGCGGG - Intergenic
1175180253 20:57141709-57141731 CAGCTTTCAATTGCCAAAGCTGG + Intergenic
1175951699 20:62587131-62587153 CTGCTGTAAGTGGGGAACGCTGG + Intergenic
1176012805 20:62908950-62908972 CTGCTATCAGAGGCCACATCTGG - Intronic
1176657965 21:9604910-9604932 GAGCTCCCAGTGGCCAAAGCTGG + Intergenic
1177432595 21:21009863-21009885 CAGCTATCAGAGGCCAAAGGAGG - Intronic
1179277674 21:39907147-39907169 ATGCTGTCAGTGGGCAGAGTGGG + Intronic
1180018366 21:45102628-45102650 GAGCTCCCAGTGGCCAAAGCTGG + Intronic
1180594923 22:16966832-16966854 CTTCAGTCAGTGGCCAGAGATGG - Intronic
1181392075 22:22590638-22590660 CTGCATTCAGAGGCCAGAGCAGG + Intergenic
1181410733 22:22717001-22717023 CTGCATTCAGAGGCCAGAGCAGG + Intergenic
1181418282 22:22776262-22776284 CTGCATTCAGAGGCCAGAGCAGG + Intronic
1181668717 22:24415690-24415712 CTGCCCTCCGTGGCCAAGGCAGG + Exonic
1182465167 22:30511082-30511104 CTCCTCTCTGTTGCCAAAGCCGG - Intergenic
1183277527 22:36908766-36908788 GAGCTGTCACTGGCCAAAGTTGG + Intergenic
1184278890 22:43426147-43426169 CTGCTGGCAGATGCCAGAGCTGG + Intronic
1184772646 22:46606986-46607008 CTGCTTCCAGTGCCCACAGCTGG - Intronic
949247448 3:1942123-1942145 GTGCTGTCACTGGCCAAATCAGG - Intergenic
949852287 3:8431291-8431313 TTGCTGCCAATGGCCAAACCTGG + Intergenic
950347760 3:12313719-12313741 GAGCTCCCAGTGGCCAAAGCTGG + Intronic
950502487 3:13373169-13373191 CTGGGGTCAGTGGCCACAGGTGG + Intronic
950521466 3:13500335-13500357 ATTCTGCCAGTGGCCAAAGCGGG - Intronic
951390918 3:22102577-22102599 TTGCTGTCACTGGCCAAATGAGG + Intronic
952304235 3:32131162-32131184 CTGGTGTCACTGGCTGAAGCTGG - Intronic
952533806 3:34289716-34289738 CTCCTGTGACTGGCCAAGGCAGG - Intergenic
954926060 3:54235662-54235684 CAGCTCCCAGTGGCCAAAGCTGG + Intronic
957298878 3:78365164-78365186 CTAATGTCATTGGACAAAGCGGG - Intergenic
957384850 3:79483056-79483078 CTGTGGTCAGTGGACAGAGCAGG - Intronic
958511025 3:95048983-95049005 CTACTGCCAGTAGCCCAAGCTGG + Intergenic
958692421 3:97484794-97484816 CTCCTGTAAATGACCAAAGCTGG + Intronic
959339909 3:105115923-105115945 GTGCAGTCAGTGGACATAGCTGG - Intergenic
961458871 3:127037802-127037824 CTGCCTTCAGTAGCCAAGGCTGG + Intergenic
961604017 3:128080201-128080223 GAGCTCTCACTGGCCAAAGCTGG + Intronic
962428121 3:135292674-135292696 GAATTGTCAGTGGCCAAAGCTGG + Intergenic
962782271 3:138730674-138730696 GTGCTTTGAGAGGCCAAAGCAGG + Intronic
964366608 3:155957275-155957297 GAGCTCCCAGTGGCCAAAGCCGG - Intergenic
965651801 3:170941826-170941848 CAGCTTCCAATGGCCAAAGCTGG + Intergenic
966523066 3:180894230-180894252 GAGCTCTCAATGGCCAAAGCTGG - Intronic
966735283 3:183182285-183182307 CTGCTGTCACTGGCCCAGGTGGG - Intronic
967627540 3:191703396-191703418 CTGCTGCCAGGGACCAAAACAGG + Intergenic
968443654 4:637139-637161 GAGCTTCCAGTGGCCAAAGCTGG - Intronic
969057715 4:4412548-4412570 CAGCTGCCCTTGGCCAAAGCTGG + Intronic
969395217 4:6916156-6916178 CGGAAGTCAGTGGCCAGAGCTGG + Intronic
969832319 4:9807770-9807792 CAGCTGTCAGTGGCCAAGGACGG + Intronic
972862195 4:43183755-43183777 GAGCTGTCAGTGGCCGAAGCTGG - Intergenic
977859633 4:101941131-101941153 CAGCTCCCAATGGCCAAAGCTGG - Intronic
978614830 4:110584166-110584188 GAGCTCCCAGTGGCCAAAGCTGG + Intergenic
978724496 4:111954630-111954652 CAGTGGTTAGTGGCCAAAGCAGG + Intergenic
979501029 4:121439955-121439977 CTGCTGCCTAGGGCCAAAGCAGG - Intergenic
983048666 4:163017883-163017905 GAGCTCCCAGTGGCCAAAGCTGG + Intergenic
983389513 4:167111645-167111667 TTGCTGACAAAGGCCAAAGCAGG + Intronic
983765759 4:171480706-171480728 CCTCTGTTAGTGGCCATAGCAGG + Intergenic
984282901 4:177693643-177693665 GTACTTTGAGTGGCCAAAGCAGG + Intergenic
985417445 4:189751167-189751189 GAGCTCCCAGTGGCCAAAGCTGG - Intergenic
985767346 5:1787013-1787035 AGGCTGTCAGGGGCCTAAGCAGG + Intergenic
985802348 5:2013022-2013044 CTGCTGCCAGGGGCCCCAGCGGG + Intergenic
986947198 5:13037186-13037208 GTGGTTTCAATGGCCAAAGCTGG + Intergenic
987518519 5:18947339-18947361 GTGCTGGCAGTGGCAGAAGCAGG - Intergenic
988715721 5:33825430-33825452 ATTTAGTCAGTGGCCAAAGCTGG + Intronic
990242674 5:53831763-53831785 CAGCTGTCACTGGCCAAATATGG + Intergenic
991029659 5:62069426-62069448 GTGCTATCACTGGCCAAATCTGG + Intergenic
991226379 5:64277848-64277870 TTGGTCTCATTGGCCAAAGCTGG + Intronic
991435175 5:66590805-66590827 GAGCTCTCAATGGCCAAAGCTGG - Intergenic
992711727 5:79465088-79465110 GTGCTGTGGGAGGCCAAAGCGGG + Intronic
994464937 5:100114733-100114755 GAGCTGTCAGTGGCAAAAGCTGG + Intergenic
994969796 5:106720811-106720833 CTGCTGTCAGTTTCCAAATCTGG + Intergenic
995068208 5:107886630-107886652 AAGCTGCCAGTGACCAAAGCTGG + Intronic
996399746 5:123048785-123048807 CTTCAGTCTGTGGCCAAAGGTGG + Intergenic
997040909 5:130252735-130252757 GAGCTCTCAATGGCCAAAGCTGG + Intergenic
997206108 5:132051156-132051178 CAGCTGTCTGTGGCCAGTGCTGG - Intergenic
997512316 5:134462159-134462181 GAGCTGTCATTGGCCCAAGCAGG + Intergenic
998492035 5:142555412-142555434 CAGGTGTCAGTGTCCCAAGCAGG - Intergenic
999307959 5:150532873-150532895 CTGCCCTCAGTGGGAAAAGCAGG + Intronic
1002407912 5:179050904-179050926 CTGCTTTCAGTGGCTACATCAGG - Intergenic
1004901146 6:20195318-20195340 CTGCTGTCAGTGGCCAAAGCTGG - Intronic
1005332315 6:24761712-24761734 CTGCTGTCACTGGCTGCAGCAGG - Intergenic
1006214198 6:32425420-32425442 CTATTGTCAGAGGCCAAACCTGG + Intergenic
1007100104 6:39240139-39240161 CTTCTGTCAGGGACCCAAGCTGG + Intergenic
1008160750 6:48072363-48072385 TTCCTTTCAGTGGCCAAAGCTGG - Intergenic
1008441330 6:51535012-51535034 CTGCTATCAGTGGGCAAGGCTGG - Intergenic
1009030414 6:58050517-58050539 GTGCTTTGAGAGGCCAAAGCAGG - Intergenic
1010543515 6:77122393-77122415 AAGCTCTCAATGGCCAAAGCTGG + Intergenic
1011557426 6:88585596-88585618 TTGCTGTCAGTGGCCAGGGCAGG - Intergenic
1012457436 6:99423200-99423222 GAGCTGCCAATGGCCAAAGCTGG + Intronic
1015420983 6:133008020-133008042 GAGCTTTCAATGGCCAAAGCTGG + Intergenic
1016795233 6:148110454-148110476 CTCATATCATTGGCCAAAGCAGG + Intergenic
1017059455 6:150468683-150468705 GAGCTCCCAGTGGCCAAAGCTGG - Intergenic
1019484670 7:1284055-1284077 CTGCTTTCAGGGGCCTAGGCGGG + Intergenic
1020477641 7:8616970-8616992 CTGAAGCCAGTGGCCCAAGCTGG - Intronic
1021125018 7:16841941-16841963 CTGATGTCAGAGGCCTCAGCTGG - Intergenic
1021579921 7:22141746-22141768 CTGCTGGCAGAGCCAAAAGCTGG - Intronic
1023056565 7:36295313-36295335 GAGCTCTCAGTGACCAAAGCTGG + Intronic
1024009543 7:45255929-45255951 CTGATGTCACTGGACAAAGCGGG - Intergenic
1024112431 7:46161016-46161038 CTGTTGCCAGTGGGCAAACCAGG - Intergenic
1024115079 7:46185214-46185236 CTGCTGCCTGTGGCCAACTCTGG - Intergenic
1024757298 7:52549952-52549974 CTGCTGTCCAGGGTCAAAGCTGG - Intergenic
1026441318 7:70446802-70446824 CTGCGGGCAGTGGCCTAAGCAGG + Intronic
1028172384 7:87614147-87614169 GTGCTTTGAGAGGCCAAAGCAGG + Intronic
1028390712 7:90313586-90313608 GAGCTCCCAGTGGCCAAAGCTGG + Intergenic
1030348426 7:108457344-108457366 CTGCTGTAAGTGGTCAAGTCGGG - Intergenic
1034144490 7:148856710-148856732 AAACTCTCAGTGGCCAAAGCTGG + Intronic
1034408110 7:150919726-150919748 GAGCTTCCAGTGGCCAAAGCTGG - Intergenic
1035565465 8:637884-637906 CTGCCTGCAGTGGCCAGAGCAGG - Intronic
1036979548 8:13454798-13454820 GTGCTTTGAGAGGCCAAAGCAGG - Intronic
1038914253 8:32002471-32002493 CAGAAGTCAGTGGCCAAAGCTGG - Intronic
1040055761 8:43056045-43056067 GTGCTGTTAGTGGCCCCAGCAGG - Intronic
1040573421 8:48629102-48629124 GTGCTGCCCGTGGACAAAGCTGG - Intergenic
1041531073 8:58867832-58867854 CTGTTGTCAGTGCCCAATTCAGG + Intronic
1043801115 8:84610804-84610826 GAGCTCTGAGTGGCCAAAGCTGG - Intronic
1047583778 8:126246221-126246243 GCGCTCTCAATGGCCAAAGCTGG - Intergenic
1049406535 8:142454049-142454071 CTGCTGTCAGGAGCCATAGGAGG + Intronic
1049412853 8:142481178-142481200 CTGCTGCCAGGGGCCAAGGGTGG + Intronic
1050224818 9:3441619-3441641 GAGCTCTCAATGGCCAAAGCTGG + Intronic
1052169249 9:25373757-25373779 CTGCTTTGAGAGGCCAAGGCGGG + Intergenic
1052295474 9:26892606-26892628 CTGCTGCCGCTGGCCAACGCGGG + Exonic
1052603618 9:30671365-30671387 CTAATGCCAGTGGCCACAGCAGG + Intergenic
1052978940 9:34433229-34433251 GTGTTCTCAATGGCCAAAGCTGG - Intronic
1054866852 9:70011554-70011576 CTGGTGACAGAGGCCACAGCTGG - Intergenic
1055693241 9:78856672-78856694 TTGCTTTCAGTAGCCAAGGCAGG + Intergenic
1056219437 9:84436669-84436691 CTGCTGTCAGTGACCAAAGTAGG - Intergenic
1056678018 9:88692919-88692941 ATGCTTTCAGAGGCCAAATCAGG - Intergenic
1056790417 9:89621890-89621912 CTGCTCTCTGCTGCCAAAGCCGG - Intergenic
1057100779 9:92357739-92357761 CTACTTTCAGAGGCCAAGGCAGG - Intronic
1057141021 9:92726890-92726912 CTGGTGGCAGAGGCCAAAGAGGG - Intronic
1057234253 9:93346262-93346284 CGGCGGGCAGCGGCCAAAGCAGG + Exonic
1057301560 9:93888639-93888661 CAGCTTCCAATGGCCAAAGCTGG + Intergenic
1057865270 9:98675242-98675264 CTTTGGTCAGTGGCCAAAGCAGG + Intronic
1057911069 9:99021111-99021133 CTGCTGCCTATGGCCAGAGCAGG - Intronic
1058853984 9:109041882-109041904 ACGCTGTCAGAGGCCGAAGCAGG + Intronic
1060671379 9:125472825-125472847 CTGGTGCCAGTGGCCAACTCTGG + Intronic
1060751561 9:126173192-126173214 GTGCTCCCAGTGGCCAAAGCTGG - Intergenic
1061369048 9:130187625-130187647 GTGCTGGCAGTGGCCAATGCTGG + Intronic
1061705194 9:132447678-132447700 CTGCTGACAGCGGCAAACGCGGG + Intronic
1062071599 9:134558202-134558224 GAGCTCCCAGTGGCCAAAGCTGG + Intergenic
1062108601 9:134769555-134769577 CCGCTGTCAATGGCTAAATCAGG - Intronic
1062311753 9:135941768-135941790 CTGCTGTCCGGGGGCAGAGCTGG - Intronic
1062436501 9:136548722-136548744 CTGCTGACATTGGCCCAACCAGG + Intergenic
1203635694 Un_KI270750v1:108485-108507 GAGCTCCCAGTGGCCAAAGCTGG + Intergenic
1186450539 X:9669741-9669763 CTGCTGACAGTGGGCATAGTGGG - Intronic
1187553040 X:20325106-20325128 GAGCTTTCAATGGCCAAAGCTGG - Intergenic
1189208435 X:39262116-39262138 GGGCTGTCAGTGGCCACAGTGGG + Intergenic
1190150190 X:47939746-47939768 GAGCTTGCAGTGGCCAAAGCTGG + Intronic
1190545574 X:51522969-51522991 CTTCAGTCTGTGGCCAAAGACGG + Intergenic
1192082416 X:68061089-68061111 CTGCTTTCTGTAGCCAAAGCTGG + Intronic
1194423179 X:93702388-93702410 GAGCTTTCAGTGGCCAAAGCTGG + Intronic
1195976311 X:110531510-110531532 CTGCAGTTAGTCTCCAAAGCAGG + Intergenic
1199627684 X:149756122-149756144 GTGCTCCCAGTGGCCAAACCTGG + Intergenic