ID: 1004904138

View in Genome Browser
Species Human (GRCh38)
Location 6:20220487-20220509
Sequence GGCAATAACTCCAATGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004904138_1004904141 6 Left 1004904138 6:20220487-20220509 CCTACCACATTGGAGTTATTGCC No data
Right 1004904141 6:20220516-20220538 AGAACTAACCCTACCCACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004904138 Original CRISPR GGCAATAACTCCAATGTGGT AGG (reversed) Intergenic
No off target data available for this crispr