ID: 1004905451

View in Genome Browser
Species Human (GRCh38)
Location 6:20233446-20233468
Sequence GAGTCTCCCCGCCCCCGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004905444_1004905451 18 Left 1004905444 6:20233405-20233427 CCCCGCAGGGCAGGGCTCAGGAC No data
Right 1004905451 6:20233446-20233468 GAGTCTCCCCGCCCCCGCCGTGG No data
1004905439_1004905451 30 Left 1004905439 6:20233393-20233415 CCTTAGCTGCCTCCCCGCAGGGC No data
Right 1004905451 6:20233446-20233468 GAGTCTCCCCGCCCCCGCCGTGG No data
1004905446_1004905451 16 Left 1004905446 6:20233407-20233429 CCGCAGGGCAGGGCTCAGGACCT 0: 39
1: 192
2: 581
3: 548
4: 710
Right 1004905451 6:20233446-20233468 GAGTCTCCCCGCCCCCGCCGTGG No data
1004905447_1004905451 -4 Left 1004905447 6:20233427-20233449 CCTGCAGCCTGCCATGCCTGAGT 0: 14
1: 198
2: 928
3: 630
4: 604
Right 1004905451 6:20233446-20233468 GAGTCTCCCCGCCCCCGCCGTGG No data
1004905445_1004905451 17 Left 1004905445 6:20233406-20233428 CCCGCAGGGCAGGGCTCAGGACC 0: 29
1: 195
2: 636
3: 680
4: 856
Right 1004905451 6:20233446-20233468 GAGTCTCCCCGCCCCCGCCGTGG No data
1004905442_1004905451 21 Left 1004905442 6:20233402-20233424 CCTCCCCGCAGGGCAGGGCTCAG No data
Right 1004905451 6:20233446-20233468 GAGTCTCCCCGCCCCCGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004905451 Original CRISPR GAGTCTCCCCGCCCCCGCCG TGG Intergenic
No off target data available for this crispr