ID: 1004906236

View in Genome Browser
Species Human (GRCh38)
Location 6:20239286-20239308
Sequence CGGAGTGGCGGGGGAGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004906236_1004906254 30 Left 1004906236 6:20239286-20239308 CCTGCGCCTCCCCCGCCACTCCG No data
Right 1004906254 6:20239339-20239361 GGAGCGCTGCCCCCTGCTCCAGG No data
1004906236_1004906248 9 Left 1004906236 6:20239286-20239308 CCTGCGCCTCCCCCGCCACTCCG No data
Right 1004906248 6:20239318-20239340 GCGCGGCCAGAGCCTCCCCGAGG No data
1004906236_1004906245 -8 Left 1004906236 6:20239286-20239308 CCTGCGCCTCCCCCGCCACTCCG No data
Right 1004906245 6:20239301-20239323 CCACTCCGTGGGCTCCTGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004906236 Original CRISPR CGGAGTGGCGGGGGAGGCGC AGG (reversed) Intergenic
No off target data available for this crispr