ID: 1004908721

View in Genome Browser
Species Human (GRCh38)
Location 6:20261116-20261138
Sequence CTAGATGCATGGTGTAGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004908721_1004908732 14 Left 1004908721 6:20261116-20261138 CCCCGCCTACACCATGCATCTAG No data
Right 1004908732 6:20261153-20261175 ACAAGTTTTGGAGGGACCTGAGG No data
1004908721_1004908728 6 Left 1004908721 6:20261116-20261138 CCCCGCCTACACCATGCATCTAG No data
Right 1004908728 6:20261145-20261167 TCCCCTCAACAAGTTTTGGAGGG No data
1004908721_1004908727 5 Left 1004908721 6:20261116-20261138 CCCCGCCTACACCATGCATCTAG No data
Right 1004908727 6:20261144-20261166 ATCCCCTCAACAAGTTTTGGAGG No data
1004908721_1004908726 2 Left 1004908721 6:20261116-20261138 CCCCGCCTACACCATGCATCTAG No data
Right 1004908726 6:20261141-20261163 GCAATCCCCTCAACAAGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004908721 Original CRISPR CTAGATGCATGGTGTAGGCG GGG (reversed) Intergenic
No off target data available for this crispr