ID: 1004909928

View in Genome Browser
Species Human (GRCh38)
Location 6:20273127-20273149
Sequence CAGAAGAATCACATGAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004909928_1004909931 0 Left 1004909928 6:20273127-20273149 CCTGACTTCATGTGATTCTTCTG No data
Right 1004909931 6:20273150-20273172 CCTCAGCGTCCCAAGTAGCTGGG 0: 283
1: 98840
2: 209829
3: 249792
4: 265140
1004909928_1004909932 8 Left 1004909928 6:20273127-20273149 CCTGACTTCATGTGATTCTTCTG No data
Right 1004909932 6:20273158-20273180 TCCCAAGTAGCTGGGACTACAGG 0: 41425
1: 153414
2: 219429
3: 225665
4: 454725
1004909928_1004909929 -1 Left 1004909928 6:20273127-20273149 CCTGACTTCATGTGATTCTTCTG No data
Right 1004909929 6:20273149-20273171 GCCTCAGCGTCCCAAGTAGCTGG 0: 233
1: 86046
2: 197015
3: 238334
4: 230116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004909928 Original CRISPR CAGAAGAATCACATGAAGTC AGG (reversed) Intergenic
No off target data available for this crispr