ID: 1004916211

View in Genome Browser
Species Human (GRCh38)
Location 6:20334500-20334522
Sequence GGTCCTTGGTTCATTGCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004916207_1004916211 -5 Left 1004916207 6:20334482-20334504 CCTGGTACGTCCCACTTAGGTCC No data
Right 1004916211 6:20334500-20334522 GGTCCTTGGTTCATTGCTATTGG No data
1004916206_1004916211 -4 Left 1004916206 6:20334481-20334503 CCCTGGTACGTCCCACTTAGGTC No data
Right 1004916211 6:20334500-20334522 GGTCCTTGGTTCATTGCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004916211 Original CRISPR GGTCCTTGGTTCATTGCTAT TGG Intergenic
No off target data available for this crispr