ID: 1004924111

View in Genome Browser
Species Human (GRCh38)
Location 6:20402581-20402603
Sequence CTGCCGCCGCGTCCCAGCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 278}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004924111_1004924117 0 Left 1004924111 6:20402581-20402603 CCAGCGCTGGGACGCGGCGGCAG 0: 1
1: 1
2: 1
3: 18
4: 278
Right 1004924117 6:20402604-20402626 CGGCGGCGGCGGCGGCCCTCCGG 0: 2
1: 6
2: 40
3: 284
4: 941
1004924111_1004924116 -8 Left 1004924111 6:20402581-20402603 CCAGCGCTGGGACGCGGCGGCAG 0: 1
1: 1
2: 1
3: 18
4: 278
Right 1004924116 6:20402596-20402618 GGCGGCAGCGGCGGCGGCGGCGG 0: 34
1: 1171
2: 1665
3: 2918
4: 5848

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004924111 Original CRISPR CTGCCGCCGCGTCCCAGCGC TGG (reversed) Exonic
900189867 1:1348818-1348840 CCCCCGCCCCGTCCCCGCGCGGG + Intronic
900227732 1:1540726-1540748 AGGCCGCCCCGTGCCAGCGCCGG + Intergenic
900473640 1:2866254-2866276 TTGCCGCCTCTTCCCAGCGTAGG - Intergenic
901791322 1:11654931-11654953 GTGCCGCGGCGGCCGAGCGCAGG + Exonic
902266768 1:15272580-15272602 CTGCAGCTGCATCCGAGCGCCGG - Intronic
902304119 1:15524295-15524317 CTGCCCCCGCGTCACGGCCCCGG + Exonic
902472518 1:16658497-16658519 CTGGAGCCACGTCCCAGGGCTGG - Intergenic
902486287 1:16748949-16748971 CTGGAGCCACGTCCCAGGGCTGG + Intronic
902808922 1:18877377-18877399 CCCCCGCCGCGGCCCAGCGGGGG - Intronic
903193576 1:21669465-21669487 CTGCCGCCCCGCCCCGCCGCAGG + Intergenic
903263416 1:22143110-22143132 CCGCCGCCGCATCCCGGCTCTGG - Intronic
903555067 1:24187256-24187278 CTGCCGCGGCGTCCCCGCCCGGG + Exonic
903628207 1:24745932-24745954 CTGCCCCGGGGCCCCAGCGCCGG + Intronic
903771154 1:25765296-25765318 CTGCCTCTGCTTCCCAGAGCTGG - Intronic
903838098 1:26219034-26219056 CTGCCACCTCTCCCCAGCGCAGG + Intergenic
903847680 1:26288233-26288255 CTCCTGCCGCCTCCCAGGGCCGG + Intronic
907051141 1:51330533-51330555 CTGCCGCCGCAACCCCGAGCCGG + Intronic
908696958 1:66854552-66854574 CTGCCTCCGCCTCCCAGTGCTGG - Intronic
911133829 1:94418435-94418457 CCGCCGCCGCGTCCCCTCGCCGG + Exonic
912305230 1:108560229-108560251 CTGCCGCCGCGTTCCGGCCCAGG + Exonic
912343042 1:108936342-108936364 CTGCCTCGGCCTCCCAGTGCTGG + Intronic
915519970 1:156436338-156436360 TAGCCGCCGCCTCCCAGCGCCGG + Intergenic
916413373 1:164569806-164569828 CTGCCTCGGCCTCCCAGTGCTGG + Intronic
916729527 1:167553638-167553660 CGGCCGCCGCGACCCCGCGCGGG + Exonic
922958484 1:229625599-229625621 CTGGCGTCGCGTTCCTGCGCAGG - Intronic
923506755 1:234611060-234611082 GCGCGGCCGCGTCACAGCGCAGG + Intergenic
1064748526 10:18502057-18502079 CTGCCTCGGCCTCCCAGTGCTGG - Intronic
1068890390 10:62142583-62142605 CTGCCTCGGCCTCCCAGTGCTGG + Intergenic
1069017156 10:63443352-63443374 CTGCCACTGCATCCCAGCGTGGG - Intronic
1070670334 10:78373173-78373195 CTGCCGCCAGATCCCAGAGCAGG - Intergenic
1071619362 10:87104904-87104926 CTGCCTCCGCCTCCCAGTGTTGG + Intronic
1072555919 10:96513615-96513637 CTGCCGCTGCCTCGCGGCGCCGG - Exonic
1073061365 10:100735673-100735695 CGGCCGCCGCGTCCTGGGGCTGG - Intronic
1075039034 10:119092996-119093018 CTGCCACCGCATTCCAGCTCTGG + Intergenic
1075406049 10:122196309-122196331 CTGCCCCCTTGTCCCAGCACGGG - Intronic
1076872661 10:133201336-133201358 CGGCTGCCGCCTCCCAGTGCAGG - Intronic
1077200471 11:1304533-1304555 CGGCCGCCCCGTCCTGGCGCGGG - Intronic
1078104487 11:8350231-8350253 CTGCCCCTGCATCCCAGCGTGGG - Intergenic
1078481613 11:11681173-11681195 CTGCCTCGGCCTCCCAGTGCTGG - Intergenic
1080458843 11:32436690-32436712 CAGCCCCCGCGCCCCAGAGCAGG + Intergenic
1080565303 11:33504010-33504032 CTGCCTCGGCCTCCCAGTGCTGG - Intergenic
1081873251 11:46392501-46392523 CTGGCGGCGCGTCCCATCCCAGG - Intergenic
1083924123 11:65795706-65795728 CTGCCCCCGCCTCTCAGCACAGG + Exonic
1084331634 11:68433780-68433802 CTGCCTCGCCGTCGCAGCGCAGG - Exonic
1084598219 11:70129868-70129890 CTGCCTCGGCCTCCCAGTGCTGG + Intronic
1085070458 11:73539514-73539536 CCGCCTCGGCCTCCCAGCGCTGG + Intronic
1085354914 11:75827360-75827382 CTGCCTCAGCCTCCCAGTGCTGG - Intronic
1088606945 11:111541331-111541353 CTGCGGCCGCCTCCCGGAGCGGG - Intronic
1088920677 11:114258062-114258084 CTGCCGCCCCCTGCCAGCCCCGG + Intronic
1089243024 11:117098117-117098139 CTGCCGCCTGGCCCCTGCGCCGG + Intronic
1089284024 11:117394310-117394332 CTGCCGCAGCTTCCCACCGGTGG + Intronic
1089347040 11:117797204-117797226 CCGCCGCCGCAGCCGAGCGCTGG - Exonic
1091973725 12:4809403-4809425 CTGCCCCGGCGCCCGAGCGCGGG - Exonic
1092385340 12:8032622-8032644 CCGCCACCGCCTCCCGGCGCGGG - Intergenic
1092743023 12:11648951-11648973 CGGCCGCCGCATCCCCGAGCGGG + Intergenic
1094684832 12:32701025-32701047 CTGCCTCAGCCTCCCAGTGCTGG - Intronic
1096636859 12:52965645-52965667 CTGCGGCTGCTTCCCAGCCCCGG + Intergenic
1096725097 12:53555070-53555092 CTGCCTCAGCCTCCCAGTGCTGG - Intronic
1096782875 12:54000980-54001002 CTGCCCCCTCCTCCCAGCCCAGG + Intronic
1096848156 12:54419080-54419102 CTGCCGCCGCCACCCAGGGTCGG - Exonic
1097995396 12:65882413-65882435 CTGCGGCAGCTTCCCAGGGCGGG - Intronic
1100329691 12:93571711-93571733 CGACCGCCGCCTCCGAGCGCGGG + Exonic
1100990455 12:100245512-100245534 CTGCTGCGGCCTCCCAGTGCTGG + Intronic
1101198903 12:102414462-102414484 CTGCCGCTGCATCCCAGCTTGGG - Intronic
1102275777 12:111580889-111580911 CTGCCTCGGCCTCCCAGTGCTGG - Intronic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1103635562 12:122302347-122302369 CTGCCTCGGCCTCCCAGTGCTGG + Intronic
1104806340 12:131591899-131591921 CGGACGCCGAGTCCCAGCGGGGG - Intergenic
1106810114 13:33350559-33350581 GTGGCGCAGCCTCCCAGCGCCGG - Intronic
1108313932 13:49220303-49220325 CGGCCGCCGCGTCCCGGGTCGGG - Intergenic
1109760584 13:66822755-66822777 CTGCCTCCACCTCCCAGTGCTGG + Intronic
1113779746 13:112969225-112969247 CAGCCGCCGCCTCCCTGCCCAGG - Exonic
1114308162 14:21442217-21442239 CTGCCTCCGCCTCCCAGTGATGG - Intronic
1114465027 14:22915741-22915763 CTGCCTCGGCCTCCCAGTGCTGG + Intronic
1119902394 14:78272490-78272512 CTGCAGCCACATCCCAGCCCAGG - Intronic
1121690964 14:95876863-95876885 CTCCCGCCGAGCCCCGGCGCGGG + Intergenic
1121756376 14:96406164-96406186 CTGCCTCAGCCTCCCAGTGCTGG + Intronic
1122130835 14:99603998-99604020 CGGCCGGCGCTTCCCCGCGCCGG + Exonic
1123758267 15:23413885-23413907 CTGCCGTCGCTCCCCAGAGCTGG + Intergenic
1124013812 15:25860309-25860331 CTGGCGAGGCGTCCCAGTGCAGG - Intronic
1124344522 15:28913385-28913407 CTGCCGCCTTGTTCCAGCTCCGG + Intronic
1125679180 15:41520333-41520355 CTGCCCCCGAGGCCCAGTGCAGG + Intronic
1126461715 15:48921580-48921602 CTGCCTCAGCCTCCCAGTGCTGG + Intronic
1126767043 15:52019590-52019612 TGGCCGGCGCGTCCCCGCGCGGG + Intronic
1130305326 15:82709426-82709448 CTGGAGCCCCGGCCCAGCGCGGG - Intronic
1132099874 15:99015433-99015455 CAGCCGAGGCGTCCCGGCGCAGG - Intergenic
1132508156 16:322885-322907 CTGCAGCTGCGTCCCAGCTCTGG + Intronic
1132578702 16:675531-675553 CTAGCACCGCGTCTCAGCGCCGG - Intronic
1132588149 16:715127-715149 CTGCCGCGCAGCCCCAGCGCCGG - Exonic
1132734637 16:1379397-1379419 CGCTCGCCGCTTCCCAGCGCGGG - Intronic
1134134054 16:11668347-11668369 CCGCCCCGCCGTCCCAGCGCGGG + Intergenic
1134167203 16:11940489-11940511 CTGCCTCAGCCTCCCAGTGCTGG - Intronic
1134493503 16:14713224-14713246 CTGCCTCGGCCTCCCAGTGCTGG + Intronic
1134498884 16:14752348-14752370 CTGCCTCGGCCTCCCAGTGCTGG + Intronic
1134525436 16:14938969-14938991 CTGCCTCGGCCTCCCAGTGCTGG + Intronic
1134546969 16:15117409-15117431 CTGCCTCGGCCTCCCAGTGCTGG - Intronic
1134547454 16:15121893-15121915 CTGCCTCGGCCTCCCAGTGCTGG - Intronic
1134581684 16:15376667-15376689 CTGCCTCAGCCTCCCAGTGCTGG - Intronic
1134713021 16:16337455-16337477 CTGCCTCGGCCTCCCAGTGCTGG + Intergenic
1134720890 16:16380815-16380837 CTGCCTCGGCCTCCCAGTGCTGG + Intronic
1134946537 16:18331070-18331092 CTGCCTCGGCCTCCCAGTGCTGG - Intronic
1134953798 16:18371217-18371239 CTGCCTCGGCCTCCCAGTGCTGG - Intergenic
1135312598 16:21417948-21417970 CTGCCTCAGCCTCCCAGTGCTGG - Intronic
1135365546 16:21850401-21850423 CTGCCTCAGCCTCCCAGTGCTGG - Intronic
1135446293 16:22520935-22520957 CTGCCTCAGCCTCCCAGTGCTGG + Intronic
1136151775 16:28355897-28355919 CTGCCTCGGCCTCCCAGTGCTGG - Intronic
1136168008 16:28469737-28469759 CTGCCTCGGCCTCCCAGTGCCGG - Intronic
1136194967 16:28645274-28645296 CTGCCTCGGCCTCCCAGTGCTGG + Intronic
1136211306 16:28759386-28759408 CTGCCTCGGCCTCCCAGTGCTGG + Intronic
1136256027 16:29039336-29039358 CTGCCTCGGCCTCCCAGTGCTGG + Intronic
1136309300 16:29396900-29396922 CTGCCTCAGCCTCCCAGTGCTGG - Intronic
1136322718 16:29498456-29498478 CTGCCTCAGCCTCCCAGTGCTGG - Intronic
1136437400 16:30238424-30238446 CTGCCTCAGCCTCCCAGTGCTGG - Intronic
1137280569 16:46973355-46973377 CCGCCGCCGACTCCCAGCCCGGG + Intronic
1137708038 16:50548714-50548736 CAGCCGCCGTGTGCAAGCGCAGG + Exonic
1139831662 16:69803658-69803680 CTGCCTCCGCCTCCCAGGTCTGG - Intronic
1139852989 16:69961904-69961926 CTGGCCCCTCTTCCCAGCGCTGG - Intronic
1139856994 16:69989318-69989340 CTGCCTCGGCCTCCCAGTGCTGG - Intergenic
1139881960 16:70184812-70184834 CTGGCCCCTCTTCCCAGCGCTGG - Intronic
1140365717 16:74378657-74378679 CTGCCTCGGCCTCCCAGTGCTGG + Intronic
1140370550 16:74410694-74410716 CTGGCCCCTCTTCCCAGCGCTGG + Intronic
1141168447 16:81676161-81676183 CTGCTGCCTCGTGCCAGCCCTGG + Intronic
1142147224 16:88497673-88497695 CAGCTGCCGGCTCCCAGCGCCGG - Intronic
1142245678 16:88969110-88969132 CTGCAGCCGAATCCCAGAGCCGG - Intronic
1142586874 17:979480-979502 CGGCCGCCGCGTCCCCCCGCAGG + Exonic
1142636382 17:1260231-1260253 CTCCCGACGCGTCCCGGCCCCGG + Intergenic
1142812047 17:2399973-2399995 CTGACCCCGCCTCCCAGAGCTGG - Intronic
1143188690 17:5025566-5025588 CTGCCTCGGCCTCCCAGTGCTGG - Exonic
1143642841 17:8209258-8209280 CTGCCTCAGCCTCCCAGTGCTGG + Intronic
1143830386 17:9645904-9645926 CGGCGGCCGCGCCCCATCGCCGG - Exonic
1143969592 17:10785908-10785930 CTGCCTCGGCCTCCCAGTGCTGG + Intergenic
1144849165 17:18235453-18235475 CTGCCACCCCCTCCCAGAGCTGG + Exonic
1146762445 17:35490181-35490203 CTGCCGCCTCGTCCCAGCGCTGG - Intronic
1147264135 17:39225048-39225070 CGGCCGCCGGGTCCCAGTCCCGG - Intronic
1147332427 17:39706721-39706743 CTGCCCCAGCGTGCCAGCCCTGG - Intronic
1147400416 17:40177554-40177576 CTGCCGCCGCAGCGCAGAGCCGG + Intronic
1147665945 17:42148159-42148181 CTGCCTCAGCCTCCCAGTGCTGG - Intronic
1150624894 17:66835321-66835343 CCGGCGCCGCGGCCCAGCACCGG - Intronic
1151898015 17:76993428-76993450 CTGCCTCAGCCTCCCAGTGCTGG + Intergenic
1152119785 17:78411395-78411417 CTGCTGCTGCCTCCCAGCTCTGG - Intronic
1152482665 17:80565559-80565581 CTCCCTCCGCCTCCCAGCCCTGG - Intronic
1152482681 17:80565611-80565633 CTCCCTCCGCCTCCCAGCCCTGG - Intronic
1152482697 17:80565663-80565685 CTCCCTCCGCCTCCCAGCCCTGG - Intronic
1152625694 17:81387030-81387052 CTCCCTCCGCGCCCCAGCTCCGG - Intergenic
1152727889 17:81956635-81956657 CTGCCGCCCACTCACAGCGCAGG + Exonic
1152747954 17:82049876-82049898 CAGCCTCCGCCTCCCAGCCCGGG + Intronic
1154118479 18:11632602-11632624 CTGCCTCAGCCTCCCAGTGCTGG - Intergenic
1154162762 18:11992089-11992111 CTGCCTCGGCCTCCCAGTGCTGG + Intronic
1155199407 18:23503823-23503845 GTCCCGTCCCGTCCCAGCGCGGG + Intronic
1156099744 18:33578740-33578762 CCGCCGCCGCGGACCGGCGCGGG - Intronic
1156596645 18:38555038-38555060 ATGCCGCTGCGCTCCAGCGCAGG + Intergenic
1157679093 18:49589699-49589721 CTGCCTCGGCCTCCCAGTGCTGG + Intronic
1158437953 18:57447255-57447277 CTGCCTCCACGCCCCGGCGCAGG + Intronic
1160501140 18:79401562-79401584 CTGGCGCCGCCTTCCAGAGCTGG + Intronic
1160507295 18:79434275-79434297 CTGCAGCCGCGTCCCTGCTGGGG + Intronic
1160739649 19:680035-680057 CAGCCCCCGCCCCCCAGCGCAGG + Intronic
1160769042 19:822122-822144 CTGGCGCCGCCTCCCACCGCCGG + Intergenic
1160983041 19:1825390-1825412 CTGCCTCGGCTTCCCAGCGTTGG - Intronic
1160992341 19:1864853-1864875 CTCCCGCCCCTTCCCAGCTCCGG + Intergenic
1161195974 19:2987002-2987024 CTGCTGGGGCGTCCCAGGGCTGG - Exonic
1161304146 19:3557586-3557608 CAGCCGCCGGGCCCCAGAGCCGG + Intronic
1161445221 19:4314732-4314754 CTGCCTCGGCCTCCCAGTGCTGG + Intronic
1162292153 19:9788276-9788298 CTGCTGCAGCCTCCCAGTGCTGG + Intronic
1162329966 19:10021713-10021735 CTGCGGCTGCCTCCCAACGCGGG + Exonic
1162441233 19:10693420-10693442 CTGCCTCGGCCTCCCAGTGCTGG + Intergenic
1163844651 19:19631505-19631527 CAGCAGCCGCTTCCCAGCTCTGG + Intronic
1165721489 19:38082424-38082446 CCGCCGCCGAGGCCCCGCGCAGG - Exonic
1165953581 19:39488443-39488465 CTGCCCCCGTGCCCCAGTGCGGG + Intronic
1165985807 19:39767828-39767850 CTGCCTCGGCCTCCCAGTGCTGG - Intergenic
1165991561 19:39818139-39818161 CTGCCTCCCCATCCCAGCCCTGG + Intergenic
1166793216 19:45410132-45410154 CTGCCTCAGCCTCCCAGTGCTGG + Exonic
1166995430 19:46717550-46717572 TCCCCGCCGCGTCCCAGCCCAGG + Intergenic
1167643976 19:50695871-50695893 GTGCCGCCCCCTCCCCGCGCTGG - Intronic
1202704909 1_KI270713v1_random:15302-15324 CTGGAGCCACGTCCCAGGGCTGG - Intergenic
927053350 2:19350314-19350336 CTGCCGGCGCGGACCAGCCCTGG - Intergenic
927684429 2:25160988-25161010 CTGCTGCCGCCTCCCAGCCTGGG - Exonic
927915103 2:26930573-26930595 CTGCCGCAGCCTCCCAGTGCTGG - Intronic
928137227 2:28696668-28696690 CTGCCTCAGCCTCCCATCGCTGG - Intergenic
929188559 2:39120286-39120308 CGGCCGCAGCCCCCCAGCGCGGG - Intronic
930338078 2:50075894-50075916 CTGCCCCAGAGTCCCAGCGGAGG - Intronic
932495672 2:72144717-72144739 GGGCCGCCGGGTCCCTGCGCGGG - Intronic
932531381 2:72537352-72537374 CTGCCTCAGCCTCCCAGTGCTGG - Intronic
933721184 2:85398653-85398675 CTGCTGCCGGGTCCCAGGGCAGG + Intronic
933775569 2:85769400-85769422 CTGCAGCCGTGTGCCAGTGCTGG + Intronic
935781556 2:106513381-106513403 CTGCAGCCTCGTGCCAGCCCCGG + Intergenic
937221451 2:120345101-120345123 CGGCGGCGGCGTCCCCGCGCCGG - Intergenic
939491434 2:142881999-142882021 CTGCCTCGGCCTCCCAGTGCTGG + Intronic
940943686 2:159592395-159592417 CTGCCTCAGCTTCCCAGTGCTGG + Intronic
944496117 2:200307709-200307731 CTTCCGCCGCATCCCCGCGCAGG - Intronic
945225603 2:207529465-207529487 GTCCGGCCGCGTCCCAGCCCGGG + Intergenic
946766019 2:223041738-223041760 CTGCCACCTCCTCCCAGCACTGG - Intergenic
948473713 2:238203390-238203412 CGCCCGCCGCCTCCCAGCGCGGG + Intronic
1168795939 20:610258-610280 CGTGCGCCGCGTCCCAGCGTCGG + Exonic
1171293327 20:23994911-23994933 CTCCCGCAGGGTCCCAGGGCTGG - Intergenic
1172529413 20:35619512-35619534 CTGCTGCCGCTCCCCAGCCCGGG - Intronic
1172583472 20:36065864-36065886 CTGCGGCCTCCTCCCAGCCCCGG - Intergenic
1172626880 20:36352431-36352453 CTGCCACCGAGTCCCAGCCACGG - Intronic
1176097784 20:63352250-63352272 CTGCCCCCGAGTCCCAGGGCTGG + Intronic
1176230711 20:64031425-64031447 CTGCCTCAGCCTCCCAGTGCTGG - Intronic
1178711020 21:34916810-34916832 ATGCCGCCGCGACCCAGGGCTGG - Intronic
1178820703 21:35972571-35972593 CTGCTGCCCCCTCCCAGGGCAGG + Intronic
1179529913 21:42011053-42011075 CGGCCGCCGGGTCCCCGCCCAGG - Intergenic
1179841866 21:44081637-44081659 CTGCCCCGGCCTCCCAGGGCAGG - Intronic
1180824388 22:18852626-18852648 CTCCCGCAGGGTCCCAGGGCTGG - Intronic
1181124814 22:20695780-20695802 CTCCCGCAGGGTCCCAGGGCTGG - Intergenic
1181188346 22:21121922-21121944 CTCCCGCAGGGTCCCAGGGCTGG + Intergenic
1181210852 22:21288571-21288593 CTCCCGCAGGGTCCCAGGGCTGG - Intergenic
1181398657 22:22638317-22638339 CTCCCGCAGGGTCCCAGGGCTGG + Intergenic
1181501389 22:23317673-23317695 CTCCCGCAGGGTCCCAGGGCTGG + Exonic
1181650764 22:24257742-24257764 CTCCCGCAGGGTCCCAGGGCTGG - Intergenic
1183524802 22:38316890-38316912 CTGCCTCCGCTTCCCCCCGCTGG - Intronic
1183642881 22:39102750-39102772 CTGCCTCGGCCTCCCAGTGCTGG - Intronic
1184156097 22:42668220-42668242 CTGCCTCGGCCTCCCAGTGCTGG - Intergenic
1203216095 22_KI270731v1_random:6859-6881 CTCCCGCAGGGTCCCAGGGCTGG + Intergenic
1203274526 22_KI270734v1_random:78530-78552 CTCCCGCAGGGTCCCAGGGCTGG - Intergenic
950032682 3:9862839-9862861 CTGTCTCCGCTTCCCAGCGCAGG + Intergenic
954743149 3:52770762-52770784 CTGCCGCCGCATCCCGACTCTGG - Exonic
956753733 3:72365571-72365593 CTGCCTCTGCATCCCAGTGCTGG - Intergenic
958416533 3:93881073-93881095 CTGCCTCAGCCTCCCAGTGCTGG - Intronic
960760447 3:121068253-121068275 CTGCCTCGGCCTCCCAGTGCTGG + Intronic
961450239 3:126999360-126999382 CTGCCTCCGGGCCCCAGGGCTGG - Intronic
968141483 3:196261407-196261429 CTGCCTCGGCCTCCCAGTGCTGG - Intronic
968434129 4:576254-576276 CCGCCGCCGCGACCCCGCGCCGG + Intergenic
968625154 4:1623633-1623655 CTGCCGCCGTGTTCCGGAGCGGG - Intronic
968642295 4:1720877-1720899 CTGCGGCCTCGTCCGCGCGCCGG - Exonic
968965147 4:3765923-3765945 CCGCCGCCGCCGCCCTGCGCTGG - Intergenic
969330610 4:6471938-6471960 CGGCCTCCGCTGCCCAGCGCCGG - Intronic
969378942 4:6782255-6782277 CTGCCGCCGCGCCCCGCCCCCGG - Intronic
969615752 4:8251739-8251761 CTGCTGCAGCCTCCCAGCGACGG - Intergenic
970823862 4:20251738-20251760 CCGCCGCCTCCGCCCAGCGCTGG + Intergenic
973318285 4:48783534-48783556 CTGCCTCGGCCTCCCAGTGCTGG - Intergenic
975570840 4:75816210-75816232 CTGCCTCAGCCTCCCAGTGCTGG + Intergenic
978503507 4:109433689-109433711 CGGCCGCCGAGTGGCAGCGCTGG + Intergenic
979278098 4:118835845-118835867 CTCCCGCCGCGTCCCCGGGCCGG + Intronic
981475270 4:145180754-145180776 CTGGCGCCGCGTCCGCGAGCAGG + Intergenic
984462990 4:180059156-180059178 CCGCCGCCGCGGCCGGGCGCAGG - Intergenic
984645838 4:182218973-182218995 CTGCCTCGGCCTCCCAGTGCTGG - Intronic
984738100 4:183130297-183130319 CTGCCTCGGCCTCCCAGTGCTGG + Intronic
988075167 5:26342972-26342994 CTGCCTCAGCCTCCCAGTGCTGG - Intergenic
991371750 5:65926186-65926208 CTGCCGCCGCCACCCGGAGCCGG - Intergenic
999223423 5:150000507-150000529 CGGCCGGGGCGTCCCACCGCCGG + Exonic
1001713035 5:173793237-173793259 CTGCCTCGGCCTCCCAGTGCTGG - Intergenic
1001801259 5:174546094-174546116 CTGCCCCTGCCTCCCACCGCAGG + Intergenic
1002184228 5:177446862-177446884 CCGCCGCCGCCTCCCCCCGCAGG + Exonic
1002570504 5:180137038-180137060 CTGCTGCCGCTTCCCGGGGCTGG - Intronic
1002633966 5:180598141-180598163 CTGCCTCCACGTGCCAGGGCTGG + Intergenic
1004492326 6:16128936-16128958 CGGCCCCCGCCTCCCAGAGCCGG - Intergenic
1004924111 6:20402581-20402603 CTGCCGCCGCGTCCCAGCGCTGG - Exonic
1007284258 6:40736419-40736441 CTGCCCCTGCCTCCCAGGGCAGG + Intergenic
1007406079 6:41637175-41637197 CCGCGGCCACGTCCCAGCGATGG - Intronic
1007565135 6:42844260-42844282 CTGCCTCGGCCTCCCAGTGCTGG - Intronic
1007616406 6:43182208-43182230 CGGCCGCTGGGTCCCAGCGAGGG + Exonic
1007994447 6:46291422-46291444 GTGCCACCGAGTCCCAGCGGTGG + Intronic
1011470569 6:87703497-87703519 CTGCCTCGGCCTCCCAGTGCTGG - Intergenic
1013060501 6:106629430-106629452 CTGCCGCCGCGACCCTGGCCCGG + Exonic
1016921546 6:149299759-149299781 CTGCCCCCGCCTCCCAGTGTTGG - Intronic
1017791112 6:157800388-157800410 CTGCCGCAGCCTCCCAGGGTTGG - Intronic
1019114896 6:169751915-169751937 CGTCCGCCGCGTTCCAGCTCAGG - Intronic
1019190061 6:170246430-170246452 CTGCAGCCGCCCCCCAGCACCGG + Intergenic
1019190101 6:170246533-170246555 CTGCAGCCGCCCCCCAGCACCGG + Intergenic
1019190166 6:170246705-170246727 CTGCAGCCGCCCCCCAGCACCGG + Intergenic
1019190192 6:170246774-170246796 CTGCAGCCGCCCCCCAGCTCCGG + Intergenic
1019190217 6:170246843-170246865 CTGCAGCCGCCCCCCAGCACCGG + Intergenic
1019190231 6:170246878-170246900 CTGCAGCCGCCCCCCAGCACCGG + Intergenic
1019190284 6:170247015-170247037 CTGCAGCCGCCCCCCAGCACCGG + Intergenic
1019457451 7:1137987-1138009 CGGCCGGTGCGTCCCGGCGCGGG - Exonic
1019543244 7:1560773-1560795 CTGCCGCCTCCTCACAGCGGCGG + Intronic
1020006471 7:4786107-4786129 CTTCCCCAGCGTCCCAGCGTAGG + Intronic
1022100104 7:27164463-27164485 CTCCCCCAGCGTCCCAGCTCCGG + Intronic
1025257670 7:57396406-57396428 CTGCCTCAGCCTCCCAGTGCTGG - Intergenic
1025729545 7:64097841-64097863 CTGCCTCAGCCTCCCAGTGCTGG - Intronic
1026195860 7:68173012-68173034 CTGCCCCCGCGTCTCTGCGTGGG - Intergenic
1028147359 7:87332782-87332804 CTGCCTCAGCTTCCCAGTGCTGG - Intergenic
1028641137 7:93043491-93043513 CAGCTGCCGCAGCCCAGCGCCGG + Intergenic
1031406914 7:121396538-121396560 CCGCCGCAGCGGCCCTGCGCCGG + Intergenic
1032013570 7:128361660-128361682 CTGCCGCGGAGCCCCGGCGCGGG - Exonic
1033253196 7:139777829-139777851 CTGCCGCCCGGGCCCGGCGCGGG + Intronic
1035601147 8:897648-897670 CTGCCGCCCCTTCCCTGCCCCGG + Intergenic
1039476561 8:37841947-37841969 CCCCCGCCGCGCCCCCGCGCAGG - Exonic
1039954078 8:42194163-42194185 CTGCCTCAGCTTCCCAGAGCTGG + Intronic
1043502808 8:80873845-80873867 CCGCCGCCGCCGCGCAGCGCCGG - Intronic
1044248961 8:89984411-89984433 CTTCCGCAGCGTCCCCGGGCAGG + Intronic
1047951563 8:129939704-129939726 CTGCCGCCGCTCCCCCGCTCCGG - Exonic
1048500669 8:134971892-134971914 CTGCCTCGGCCTCCCAGTGCTGG + Intergenic
1049918106 9:337904-337926 CTGCCTCGGCCTCCCAGTGCTGG - Intronic
1051235373 9:14993375-14993397 CTGCGGCCCCGCCCCCGCGCCGG - Intergenic
1053503201 9:38620040-38620062 CTGCGGCCCCCTCCCACCGCGGG + Intergenic
1058515283 9:105766046-105766068 CTGCCTCGGCCTCCCAGTGCTGG + Intronic
1059320257 9:113463550-113463572 CTGCCGTCGCTGCTCAGCGCGGG + Intronic
1059777399 9:117489168-117489190 CTGCCTCAGCCTCCCAGTGCTGG - Intergenic
1061156028 9:128862248-128862270 CTGCCGCAGCGTCCCAGTGCTGG + Intronic
1061293633 9:129665937-129665959 CAGTCGCCGGGCCCCAGCGCGGG - Exonic
1061556529 9:131373405-131373427 CTCCCGCAGGGTCCCGGCGCCGG - Intergenic
1062230515 9:135479574-135479596 CTGCCGCCGCGCCCGCGCCCCGG - Intronic
1062376351 9:136263586-136263608 CTGCAGCTGAGTCCCAGCCCAGG + Intergenic
1190323273 X:49190922-49190944 CTGCCGCCTCTCCCCAACGCTGG - Intronic
1192175207 X:68880926-68880948 CTGCCCCCCCTTCCCAGGGCTGG + Intergenic
1195668395 X:107450055-107450077 CTCCCGCCGCGACCCACCCCCGG - Intergenic
1197749951 X:129957403-129957425 CTGTCGCCGCGGCGCAGGGCCGG - Intergenic