ID: 1004924532

View in Genome Browser
Species Human (GRCh38)
Location 6:20403859-20403881
Sequence CGCCGACGCCGCGGGGGCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004924517_1004924532 18 Left 1004924517 6:20403818-20403840 CCCTTACAGCAGCAGGTTAGTGA 0: 1
1: 0
2: 1
3: 6
4: 106
Right 1004924532 6:20403859-20403881 CGCCGACGCCGCGGGGGCACCGG 0: 1
1: 0
2: 1
3: 12
4: 150
1004924518_1004924532 17 Left 1004924518 6:20403819-20403841 CCTTACAGCAGCAGGTTAGTGAC 0: 1
1: 0
2: 1
3: 36
4: 398
Right 1004924532 6:20403859-20403881 CGCCGACGCCGCGGGGGCACCGG 0: 1
1: 0
2: 1
3: 12
4: 150
1004924526_1004924532 -5 Left 1004924526 6:20403841-20403863 CCGGGACGGCTCGGGGGCCGCCG 0: 1
1: 0
2: 0
3: 13
4: 157
Right 1004924532 6:20403859-20403881 CGCCGACGCCGCGGGGGCACCGG 0: 1
1: 0
2: 1
3: 12
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004924532 Original CRISPR CGCCGACGCCGCGGGGGCAC CGG Intronic
900364811 1:2306790-2306812 CGCCGACAACGCGGGTGCAGGGG + Exonic
901026226 1:6280044-6280066 AGCAGACGCCGCGGGGGCAGGGG + Intronic
901797940 1:11691492-11691514 CGCCGCCGCCGCGAGGGCGCGGG - Exonic
902286111 1:15409796-15409818 CGCGCACGCCGCGCGGGCCCGGG + Intergenic
908131839 1:61082370-61082392 CGCCGCCGCCGCGGGGGGGAGGG - Intronic
908401135 1:63774062-63774084 CGCCGCCGCCGAGGGAGCCCCGG + Exonic
908534637 1:65066703-65066725 CGCCGCCGCCGCGGGGACTCCGG + Intergenic
915355907 1:155255127-155255149 CGATGAGGACGCGGGGGCACCGG + Exonic
921029813 1:211327107-211327129 CGCCGACGGCCCGGGGACAGCGG + Intronic
921882722 1:220272523-220272545 CGCCTAGGGCGCGGGGGCCCGGG + Intergenic
921909083 1:220528292-220528314 CGCCGCCGCCGCTGGGCCCCGGG + Intronic
1064208966 10:13347770-13347792 CGCCGCCGCCGCGCGGGGCCGGG - Intronic
1066370282 10:34814460-34814482 CTCCCAGGCCCCGGGGGCACAGG - Intronic
1067572925 10:47384659-47384681 CGCCGAGGCCCCGCGGGCCCAGG - Intergenic
1070800829 10:79243551-79243573 CGGCGGCGGCGCGGGGGCCCGGG - Intronic
1075699761 10:124461795-124461817 CGCCGGCGCCGCGGCCGCGCAGG - Intergenic
1076793650 10:132788810-132788832 TGCAGACGCCGCGGGGGTGCCGG - Intergenic
1078442328 11:11378249-11378271 CTCCCACTCCCCGGGGGCACAGG + Intronic
1079689409 11:23403540-23403562 CGCCGCCGCCGCCGCGGGACGGG + Intergenic
1081832051 11:46121967-46121989 CGCCGCCGCCGCCGCTGCACTGG - Intergenic
1083595546 11:63916959-63916981 CGCCGCCGCCGCCGGTGCCCCGG - Intergenic
1083617966 11:64035779-64035801 CGCCGCCGCCGCGAGGGGAGAGG + Intronic
1088663813 11:112074420-112074442 CTCCGAGGCCGCTGGGGAACAGG + Exonic
1089262503 11:117232526-117232548 AGCTGGCGCCGCCGGGGCACGGG - Intergenic
1091823169 12:3491301-3491323 CGCCGCCGCCGCGGAGGCTTCGG + Exonic
1092727682 12:11500720-11500742 CGCCGCCACCGCCGGGGCCCAGG + Intronic
1096983734 12:55743390-55743412 CGCCGCCGCCGCGGGGCCCTCGG - Exonic
1097262292 12:57726557-57726579 CGCCGACGCCCCGGTTGCGCTGG - Exonic
1097264414 12:57737508-57737530 CGCCGCCGCCGCCGGGGGAGGGG - Exonic
1102518481 12:113465333-113465355 CGCGCACGGCGCGGGGGCAGCGG - Intronic
1102519842 12:113471502-113471524 GGCCGAAGCCGCCGGGGCGCGGG - Exonic
1103364012 12:120369332-120369354 CGCCGCCTCCGCGGGCGCCCGGG - Intergenic
1107851386 13:44576466-44576488 CGCCGACGCGGCGGGAGGAGGGG - Exonic
1112216315 13:97434311-97434333 CGCCGCCGCCGCCGGCGCCCAGG + Exonic
1115651160 14:35403976-35403998 CGCCGGGGCCGCGGGGGGAGGGG - Intronic
1120905689 14:89619173-89619195 CGCCGACCCCGGGCGGGCGCCGG - Intergenic
1122231199 14:100306975-100306997 CACCGCCGCCGCGGGCGCGCAGG - Intergenic
1122544975 14:102517157-102517179 CGCCGAGGCCGCGGGGCGAGGGG - Intergenic
1122975027 14:105167551-105167573 CGCCGGGGCCCCGGGGCCACCGG - Intronic
1122975458 14:105168941-105168963 CGCCCGGGCGGCGGGGGCACGGG + Intergenic
1123024875 14:105419857-105419879 CGCCGAGGCCGCGCAGGGACGGG - Exonic
1123964271 15:25439181-25439203 TGCCGTCGCCGCCGGCGCACGGG + Intergenic
1124579563 15:30941607-30941629 CACCGACACCTCGGGGACACCGG - Exonic
1124848083 15:33311027-33311049 CGCCGACGCCTCGGGAGCCATGG + Exonic
1125508785 15:40282025-40282047 CGCCGCCGCCGCTGCGGCCCGGG - Exonic
1129844990 15:78764081-78764103 CGCCGCAGCTGCGGGAGCACTGG + Exonic
1130224557 15:82046987-82047009 CGCCGCCACCGCGGGGACGCAGG + Intergenic
1131215238 15:90530342-90530364 CGCCGAGGCCGCGGCCGCTCCGG - Intronic
1132641872 16:981774-981796 CGCCGCCGCCGCCGAGGCTCGGG - Intergenic
1132889534 16:2196885-2196907 CGCGGCCGCCGGGGGTGCACTGG + Intergenic
1132889543 16:2196911-2196933 CCCCGACGCGGCGGCGGCGCGGG + Intergenic
1132974125 16:2703054-2703076 CGCAGACTCTGCGGGGGCTCAGG + Intronic
1138651346 16:58463352-58463374 ACCCGACGCCGCGCGGCCACAGG + Intronic
1139364833 16:66427048-66427070 CGCCGCCGCCGAGGGGGGCCGGG + Intergenic
1139637119 16:68264515-68264537 CGCCGCCGCCGCGGCAGCTCAGG - Intronic
1141079236 16:81036043-81036065 CGCCGGCGGCGCGGGGACAGCGG - Exonic
1141840129 16:86568576-86568598 CGCCTGCGCCGCGGCGGCCCCGG - Exonic
1142810560 17:2393796-2393818 CGCCGAGGCTGCAGGGGCTCGGG + Intronic
1142848129 17:2691926-2691948 GGGCGGGGCCGCGGGGGCACGGG - Intronic
1143554426 17:7651671-7651693 GGGCGACGCCTCGGGGGCGCAGG + Intronic
1144565112 17:16353353-16353375 CGCGGAGGCCGCGGGGGCCGCGG + Exonic
1144816654 17:18039745-18039767 CGCGGAGGCAGCGGAGGCACCGG - Exonic
1145094075 17:20009569-20009591 CGTCTTCGCCGCGGGGGCCCCGG + Intronic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1146053306 17:29568659-29568681 CGCGGGCGGCGCGGGGGCGCTGG + Exonic
1148556595 17:48582224-48582246 CGCCGCCGCCGCCGGTGCGCAGG - Intronic
1148787200 17:50151115-50151137 CGCAGCCGCCGCTGGGGGACTGG + Intergenic
1152222148 17:79074841-79074863 CGCTGACGCCGCGCTGGGACGGG - Intergenic
1152468554 17:80478360-80478382 CGCAGACCCCGCGTGGGGACCGG - Intergenic
1152646012 17:81468900-81468922 CTCAGCCGCCGCGGGGTCACCGG + Intergenic
1152718704 17:81911914-81911936 CGCCGACCACTCGGGGACACCGG + Intergenic
1152809007 17:82372307-82372329 CGCAGAAGCCGAGGGTGCACCGG - Intergenic
1153805311 18:8705333-8705355 CGCCAGCGCCGCCGCGGCACCGG + Intergenic
1155053819 18:22169038-22169060 CGCCGCCGCCGCGGCGGGAGGGG - Intergenic
1158954165 18:62523606-62523628 CGCCGCCGCCCCGGGGACTCGGG + Exonic
1160907227 19:1457029-1457051 CGCCGGGGCCCCAGGGGCACCGG + Exonic
1162128245 19:8510882-8510904 CGCGGGGGCCGCGGGGGCGCCGG + Exonic
1162145508 19:8610655-8610677 CGGCGACGGCGCGGAGGCCCCGG - Intronic
1162145590 19:8610907-8610929 CTCCCACGCGGCGGGGGCGCTGG - Intergenic
1163116600 19:15192377-15192399 CTCGGAAGCCACGGGGGCACCGG + Exonic
1163365915 19:16876141-16876163 CGCGGACGCAGCGGGAGGACAGG - Exonic
1163436943 19:17301544-17301566 CCCCAACGCCGTGGGGCCACTGG - Exonic
1167077045 19:47256582-47256604 CGCGGACGCCGCGGGGTCTCCGG + Exonic
924985014 2:263455-263477 CGCCGGGGTCGCGGGGCCACAGG - Intronic
927652293 2:24920042-24920064 CGCCGCCGCCGCGGGTGCAGGGG - Intergenic
927714046 2:25341433-25341455 CGCCGCTGCCGCAGGGGCCCCGG - Intronic
927943317 2:27119064-27119086 CGCGGGCGCAGCGGGGGCGCTGG - Exonic
931711001 2:64989166-64989188 ACCCGAGGCCGCGGGGGCGCGGG - Intronic
932591526 2:73070800-73070822 CCCCGGCGGCGCGGGGGCCCGGG + Intronic
934933213 2:98445115-98445137 CGCGGCCGCCGCGGGGGCCGGGG + Intronic
938414555 2:131093428-131093450 CGCCGACGCTGCGCAGCCACCGG + Exonic
942151064 2:173076156-173076178 CGCCGCCGCCGGGCGGGCCCTGG - Intronic
942241109 2:173964676-173964698 CGCCGCCGCCGCCGGGGGGCGGG - Intronic
946921424 2:224585152-224585174 CGCCGCCGCCGCGGCTGCCCAGG - Exonic
1175429198 20:58890649-58890671 CGCAGAGGCCGCGGGCGCTCCGG + Intronic
1178513828 21:33229896-33229918 CGCCGCCGGCGCGGGGGCGGGGG - Intronic
1178992482 21:37367203-37367225 CGCCGCCGCCGCCCGGGCCCCGG + Intronic
1180614777 22:17120241-17120263 CGCGGAGCCCGCGGGGGCGCCGG - Exonic
1181032569 22:20155398-20155420 CGCGGTTGCGGCGGGGGCACTGG + Intergenic
1181478095 22:23180839-23180861 CGCCGCCGCCGCGCGGGCCATGG + Exonic
1181510856 22:23388215-23388237 CGCGGCTGCGGCGGGGGCACTGG - Intergenic
1185278624 22:49960659-49960681 CGCCGCCGCCTCGCGGGCCCCGG + Exonic
950912160 3:16605549-16605571 CGCCCACGCGGCGGGGGCGTAGG + Intronic
951025012 3:17818488-17818510 TGCCGAGGCCGAGGAGGCACCGG + Intronic
952241158 3:31532712-31532734 CGCCGCCGCCGCAGCTGCACTGG + Intronic
952886016 3:38011328-38011350 CGCCGAGGCCGCGGGCTCAGGGG - Exonic
956844751 3:73172271-73172293 CGCAGACGCCTCTGGGGCAATGG + Intergenic
959530734 3:107431541-107431563 CGCCGCCGCCGCCGGGGCTCGGG + Intergenic
965648332 3:170908304-170908326 CGTCGCCGCCGCGGCCGCACAGG + Intronic
967904101 3:194486792-194486814 CGCCGCCGCCGCGGGCGCGGAGG - Intronic
968410586 4:386583-386605 CGCCGACGCGGCGTGCGCAGTGG + Intergenic
968649727 4:1755747-1755769 CGCCCAGGCCCCGGGGGCAGGGG + Intergenic
968674611 4:1870997-1871019 CGCCCACGGCTCGGGGGCGCCGG + Intergenic
969559688 4:7939357-7939379 CAGCCACGCCGCGGGGGCACCGG + Exonic
970202880 4:13627489-13627511 CGCCGCCGCCGCCGGGCCCCGGG - Exonic
980130062 4:128809965-128809987 CGCCGTCGCCGCCGCGGGACCGG - Intronic
983576996 4:169270953-169270975 CTCTGACGCCGCGGCGGCACCGG + Exonic
990955153 5:61332812-61332834 CGCCGCCGCCGCGGGGGCCGGGG + Exonic
993902469 5:93593907-93593929 CTCCAAAGCCGCGGGGACACCGG + Exonic
994043615 5:95284655-95284677 CGCCAGCGCCGCGGGGACCCGGG - Intergenic
995650411 5:114362363-114362385 CGCCCCCGCCGCCGGGGCACCGG - Exonic
997975411 5:138439070-138439092 AGCAGCCGCCGCGGGGGCAGCGG - Exonic
998374522 5:141682074-141682096 CGCCGGCGCCGAGGGGGCCTGGG + Intronic
999252324 5:150190224-150190246 CGCGGGAGCCGCGGGGGCAAAGG + Exonic
1004924532 6:20403859-20403881 CGCCGACGCCGCGGGGGCACCGG + Intronic
1008932469 6:56954936-56954958 CGCCGCCGCCGCGGCCGCCCGGG + Intergenic
1015181504 6:130366233-130366255 TGCCCGCGCCGGGGGGGCACCGG - Intronic
1019276615 7:179251-179273 CGGCGACTCCTCGGGGACACCGG + Intergenic
1019361258 7:605239-605261 CGCTGACTCCGCAGGGGCTCGGG + Intronic
1019421802 7:954275-954297 CGCGGACGCCGCGGGGGTGGCGG - Intronic
1020278237 7:6637322-6637344 CGACGGCGGCGCGTGGGCACCGG - Exonic
1025069676 7:55887590-55887612 CGCCGCCGCCGCGGTGGACCCGG - Intronic
1028621810 7:92834950-92834972 TGCCGAGGCCGCGGCGGCCCTGG - Intronic
1029109562 7:98205717-98205739 GGCCGCGGCCGCGGGTGCACGGG - Exonic
1029168943 7:98617494-98617516 CGCCGTGGCCGCTGGGGCCCAGG + Exonic
1029535277 7:101154337-101154359 CGCCGACGCCGCGGGGAGCGCGG - Intergenic
1029701419 7:102248910-102248932 CCCCGAGGCCGCGGGCGCCCGGG + Exonic
1031051882 7:116953440-116953462 CGCCGCCGCCGCCGCGGCCCGGG - Exonic
1034264130 7:149773126-149773148 CGCCCGCGCCGCGGGGACCCAGG + Exonic
1035169534 7:157009939-157009961 CGCCGCCGCCGCTGGGGGCCTGG - Exonic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1045211661 8:100106009-100106031 CGGCGACGGCGCGCGGGCTCCGG + Exonic
1045222507 8:100213005-100213027 CGCGGAGGCCGCGGGGGTGCAGG - Intronic
1045674067 8:104588986-104589008 CGCCGCCGCCGCCGAGCCACCGG + Exonic
1047499585 8:125431010-125431032 CGCCGACGACGCGGCGGCTGTGG + Exonic
1049585306 8:143430169-143430191 CGCCGCCGCCGCCGGTGCCCGGG + Exonic
1049693753 8:143973739-143973761 CGCCGACACCGCGGTCGCCCGGG + Intronic
1053304525 9:36974820-36974842 CGTCGAGGCCTCGGGGGCTCAGG - Intronic
1054798636 9:69325418-69325440 CGCGGCCGCAGCGGGGGCAGCGG - Intronic
1054835650 9:69672545-69672567 CGCCGCCGCCGCGGGCTCGCGGG - Intergenic
1055514231 9:77020415-77020437 CGCCGCGGCCGCGGCGGCAGCGG - Exonic
1055985575 9:82054827-82054849 CGCCGAAGCCGAGGAGGCACTGG + Intergenic
1057146814 9:92764366-92764388 CGCCGGGGCGGAGGGGGCACGGG - Intronic
1057361148 9:94374755-94374777 CGGCGACGCCGCGGAGGCGGCGG - Exonic
1057432322 9:95005242-95005264 CGCCGGCGCCACCGGGGCGCAGG - Intronic
1057489151 9:95508376-95508398 CGCCGCCGCCGCGGGGACGGAGG + Exonic
1057489274 9:95508880-95508902 CGCCGCCGCCGCGGGGTCCGAGG + Intronic
1057662213 9:97013409-97013431 CGGCGACGCCGCGGAGGCGGCGG + Exonic
1060897270 9:127225638-127225660 CGCCGAAGCCGCGGGCGTGCGGG - Intronic
1061050734 9:128193197-128193219 CGCCGACGTCCCCGGGGCCCTGG - Intronic
1061721958 9:132557354-132557376 AGCCACCGCCGTGGGGGCACGGG + Intronic
1062346722 9:136118485-136118507 CGCCGCCGCGGAGAGGGCACCGG - Exonic
1185457753 X:319231-319253 CGCCGCCGCCGCCGAGGCTCGGG - Intergenic
1197712055 X:129678492-129678514 CGCCTACGCACCGGGGGCACTGG + Intergenic