ID: 1004924591

View in Genome Browser
Species Human (GRCh38)
Location 6:20404076-20404098
Sequence TTTTCTAGGGGGCGGATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 165}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004924583_1004924591 10 Left 1004924583 6:20404043-20404065 CCAGGGGGTGGGTATGGTGTTTA 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1004924591 6:20404076-20404098 TTTTCTAGGGGGCGGATGGATGG 0: 1
1: 0
2: 1
3: 9
4: 165
1004924582_1004924591 11 Left 1004924582 6:20404042-20404064 CCCAGGGGGTGGGTATGGTGTTT 0: 1
1: 0
2: 1
3: 16
4: 167
Right 1004924591 6:20404076-20404098 TTTTCTAGGGGGCGGATGGATGG 0: 1
1: 0
2: 1
3: 9
4: 165
1004924581_1004924591 12 Left 1004924581 6:20404041-20404063 CCCCAGGGGGTGGGTATGGTGTT 0: 1
1: 0
2: 0
3: 10
4: 142
Right 1004924591 6:20404076-20404098 TTTTCTAGGGGGCGGATGGATGG 0: 1
1: 0
2: 1
3: 9
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004924591 Original CRISPR TTTTCTAGGGGGCGGATGGA TGG Intronic
901078752 1:6571818-6571840 TTTTTTGGGGGGAGGATGGAGGG - Intronic
903872606 1:26447460-26447482 TTTTCTAGGGAAAGGCTGGAAGG + Intronic
904314324 1:29650554-29650576 TTTTTTGGGGGGTGGGTGGATGG + Intergenic
904593090 1:31626196-31626218 TTCTCAAGGGGGAGGAGGGAAGG - Intronic
907066939 1:51493617-51493639 TTTTTTGGGGGGTGGATGGGAGG + Intronic
907933165 1:59018838-59018860 TTTGCTAGGGGAAGGAAGGAGGG + Intergenic
910873340 1:91854522-91854544 TTTTATAGGGGGCTGTAGGAAGG - Intronic
911115820 1:94246516-94246538 TTTTTTGGGCGGGGGATGGAGGG - Intronic
914321099 1:146561093-146561115 GCTTCTAGGTGGAGGATGGAGGG - Intergenic
919549777 1:198970480-198970502 TTTTTTAGTGGGGGGCTGGAGGG + Intergenic
920037419 1:203075348-203075370 GTCTCTGGGTGGCGGATGGAGGG - Intronic
920281437 1:204846588-204846610 ATTCCTAGGTGGGGGATGGAGGG + Intronic
921393350 1:214639833-214639855 TTTGCCAGGGGGCGGGGGGAGGG + Intronic
1062937485 10:1399210-1399232 TTTTCTAAGAGGCTGAAGGAGGG + Intronic
1063609646 10:7552012-7552034 TTATGTAGGGGGTGGAGGGATGG - Intergenic
1066378322 10:34879656-34879678 GTTTCTAGGAGGCAGAAGGAAGG + Intergenic
1067900991 10:50241402-50241424 TTTTCTAGGTGGTGGATAGAAGG - Intronic
1067901977 10:50251357-50251379 TTTTCTTGGGGAAGGAGGGAAGG - Intergenic
1069722202 10:70556968-70556990 CTTTCTAGTGAGTGGATGGAGGG + Intronic
1073469793 10:103715500-103715522 TTTCCTAGGAGGCAAATGGAAGG - Intronic
1073738239 10:106375331-106375353 TTTTTTAGGTGGGGGAAGGAAGG + Intergenic
1074256516 10:111807770-111807792 TTTGCTGGGGGGTGCATGGAAGG + Intergenic
1074860200 10:117504157-117504179 CTTTCTAGGGGGTGGTGGGATGG - Intergenic
1074866506 10:117547121-117547143 TTTCCTAGGGGGCCGTGGGATGG + Intronic
1075648679 10:124113184-124113206 TTTTCTAGGGCCCTGATGGGAGG - Intergenic
1079335173 11:19564660-19564682 ATTTCTAGGGGACGGCAGGAAGG - Intronic
1081404084 11:42676228-42676250 TTTTGTGGGGGGCGGATGGAGGG - Intergenic
1082928280 11:58574559-58574581 TTTTTTTTGGGGGGGATGGAGGG - Intronic
1084458347 11:69282147-69282169 TTTTCTAGTGGGCTGCTTGAGGG - Intergenic
1085072128 11:73556380-73556402 TTTGCTAGTGGTGGGATGGAGGG - Intronic
1089934556 11:122350376-122350398 GCTTCTTGGGGGCGGAAGGATGG + Intergenic
1091089320 11:132754901-132754923 TGTTCTAGGGGTGGGATGCATGG + Intronic
1094500815 12:31019480-31019502 TTTTCCAGGGGCCGAGTGGAGGG + Intergenic
1098383984 12:69899212-69899234 ATTTCTAGTGGGGGGATGAATGG - Intronic
1102292999 12:111716201-111716223 TTTTTTTGGGGGGGGATGGGGGG - Intronic
1103097757 12:118145694-118145716 TGTTCTAGGGGCCATATGGAGGG + Intergenic
1107676206 13:42799883-42799905 ATTCCTAGAGGGGGGATGGATGG + Intergenic
1111845959 13:93508770-93508792 TTTTCTAGGGAAAGGGTGGAGGG + Intronic
1115267775 14:31518961-31518983 TTTGCTAGTGGGTGGATGAATGG - Intronic
1115572217 14:34677346-34677368 TTTTGTAGGGGCTGGATGGTGGG + Intergenic
1115997835 14:39212077-39212099 CTCTCTAGGGGGATGATGGAGGG - Intergenic
1116825988 14:49674095-49674117 TTTGGTAGGGGGCGGAGGGGAGG - Intronic
1117810562 14:59541326-59541348 TTTTCTTGTGGTAGGATGGATGG + Intronic
1120974425 14:90236140-90236162 TTTTCTGGGGGTAGGAAGGAGGG - Intergenic
1122679791 14:103450336-103450358 TTTTGTGGGGGGCGGGAGGACGG - Intronic
1126477808 15:49084479-49084501 TTTTCTGGGGGAGGGCTGGAGGG - Intergenic
1126699342 15:51354146-51354168 TTTTCTGGGTGGCAGATGAAGGG - Intronic
1130767745 15:86889345-86889367 TTTTCTGGGGGGTGGGTGGGGGG + Intronic
1131779184 15:95837569-95837591 TCTTCTTGGGGGAGGATGCAGGG - Intergenic
1132687229 16:1167415-1167437 TTCTCCAGAGGACGGATGGAGGG - Intronic
1132757666 16:1493801-1493823 GTTTCTAAGGGGCGGAGGAATGG + Intronic
1134050735 16:11135495-11135517 TTTTCTGGGAGGTGGAGGGAGGG + Intronic
1135997154 16:27259118-27259140 TTTTCTAGCAGGCAGTTGGAGGG - Intronic
1137426137 16:48382628-48382650 TTTTTTGGCGGGGGGATGGAAGG + Intronic
1138465377 16:57186280-57186302 TTTCCTAGGGGACTGAGGGAGGG + Intronic
1140555328 16:75915259-75915281 TCTTCTAGGTGAGGGATGGAAGG - Intergenic
1140773791 16:78230782-78230804 TAGACTAGGGGGCTGATGGAGGG + Intronic
1140837966 16:78812719-78812741 TTTTTTAGGGGGTGGGAGGATGG - Intronic
1140920490 16:79533231-79533253 TTTTAAAGGGGGCAGAGGGATGG + Intergenic
1141096754 16:81168380-81168402 ATGACTAGGGGACGGATGGATGG + Intergenic
1141697322 16:85626222-85626244 TTTTCTTGGGGGTGGAGGCAAGG - Intronic
1141770915 16:86089197-86089219 TCTTCTAGGTGGGGGATGGGGGG + Intergenic
1142298166 16:89240831-89240853 TTTTTTGGGGGGCGGGGGGAAGG - Intergenic
1148007088 17:44441717-44441739 TTTTTTGGGGGGCGGGGGGAAGG - Intronic
1148436964 17:47692913-47692935 TCTCCGAGGGGGAGGATGGAAGG - Intergenic
1151206658 17:72513030-72513052 TCTTCTGGTGGGAGGATGGAGGG - Intergenic
1155324055 18:24648364-24648386 ATTTCTGGGGTGGGGATGGAGGG + Intergenic
1156074710 18:33259767-33259789 TTTTCTTGGGGGCTCATTGAAGG + Intronic
1157743917 18:50118142-50118164 TTTAGTTGGGGGCGGGTGGATGG - Intronic
1159669800 18:71209291-71209313 TTTTTGCGGGGGCGGGTGGAAGG + Intergenic
1159695789 18:71554321-71554343 TTTTTTTGGGGGGGGATGGAGGG + Intergenic
1160714581 19:570572-570594 TTCTATAGGGGAGGGATGGAGGG + Intergenic
1161550872 19:4911336-4911358 TTTTGGAGGTGGCCGATGGAAGG + Intronic
1161801956 19:6421274-6421296 TTACCTTGGGGGAGGATGGATGG + Exonic
1163365227 19:16872331-16872353 ATTTGAAGGGGGCAGATGGATGG + Intronic
1163512880 19:17746604-17746626 TTGTCTAGGGCTGGGATGGAGGG + Intergenic
1166691099 19:44821494-44821516 CTTGCAAGGGGGCGGATGGGGGG - Intergenic
926259762 2:11248208-11248230 TTTTTTTGGGGGGGGATGGGGGG + Intronic
927495262 2:23547664-23547686 TTTTCTCGGGGGAGGCGGGAGGG - Intronic
928147102 2:28788852-28788874 TTTTTTTGGGGGCAGACGGAGGG + Intronic
928969756 2:37015522-37015544 TATTTTAGGGGGCGGGTGAAGGG + Intronic
929630267 2:43452913-43452935 TTTTTTTGGGGGTGGGTGGAGGG - Intronic
931986456 2:67747031-67747053 TTTGCTGGTGGGTGGATGGATGG + Intergenic
935036970 2:99386703-99386725 TTTTCTGGGGGGCGGGGGGGCGG + Intronic
937231730 2:120401764-120401786 TGTTCTAGGGCGTGGATGGGTGG + Intergenic
937481900 2:122270122-122270144 GTTTCCAGGGGATGGATGGAGGG - Intergenic
938287641 2:130130482-130130504 TATTCTGGGGGGTGGATGGAGGG + Intergenic
938427952 2:131208377-131208399 TATTCTGGGGGGTGGATGGAGGG - Intronic
942235927 2:173904846-173904868 TTTTGTGGGGGAAGGATGGAGGG + Intergenic
943019850 2:182560021-182560043 TTTTCTTGGTGGCAGAGGGATGG + Intergenic
946252774 2:218423696-218423718 TTCTCTAGGGGCAGGCTGGAAGG + Intronic
946987897 2:225293703-225293725 TTTTCTAGAAGGCGAATGAATGG + Intergenic
947593069 2:231395947-231395969 GTTTCCCGGGGGCGGATGGGCGG + Intronic
948052984 2:234992325-234992347 TTTTCTTCGGGGTGGCTGGAGGG + Intronic
1170193711 20:13669285-13669307 TTTTTTGGGGGGGGGATGGGAGG + Intergenic
1171508694 20:25661585-25661607 TTTACTAGGGTGTGGAGGGAAGG + Intergenic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1176299872 21:5094603-5094625 GTTGCGAGGGGTCGGATGGACGG - Intergenic
1176514170 21:7771037-7771059 TTTTCCAGGTGGCAGAAGGAAGG + Intronic
1176519551 21:7814348-7814370 TTTTCTGGGGTCGGGATGGAGGG - Intergenic
1176728532 21:10465763-10465785 TTTTCTAGGGAGGAGGTGGAGGG + Intergenic
1178430807 21:32517290-32517312 TTTTCCAGGGGCTGGAGGGAGGG - Intergenic
1178607910 21:34055469-34055491 TGGTCTTGGGGGCAGATGGAAGG + Intergenic
1178648283 21:34401561-34401583 TTTTCCAGGTGGCAGAAGGAAGG + Intronic
1178653579 21:34444361-34444383 TTTTCTGGGGTCGGGATGGAGGG - Intergenic
1178995595 21:37396219-37396241 TTTTTTAGGTTGGGGATGGAGGG + Intronic
1179857150 21:44167308-44167330 GTTGCGAGGGGTCGGATGGACGG + Intergenic
1181719835 22:24765114-24765136 TTTTCAAGAGGGCAAATGGATGG + Intronic
1182104993 22:27682797-27682819 ATTTCTAGGGGGCTTCTGGAGGG - Intergenic
1184037460 22:41925595-41925617 TCTTCTAGGGGAGGGAGGGAAGG - Intronic
949864596 3:8537167-8537189 TTTTCCTGGGGGTGGGTGGATGG - Exonic
950729136 3:14941539-14941561 CTTTCTGGTGGGGGGATGGAGGG + Intergenic
953784750 3:45902754-45902776 TTTTCTAGGGAGCAGACAGACGG - Exonic
954912911 3:54123155-54123177 TTTTTTGGGGGGGGGATGGGTGG + Intronic
955867071 3:63396400-63396422 ATGTCTAGGGGGAGGAAGGAGGG + Intronic
957414923 3:79889629-79889651 TTTTTTAGGGGGTGAATGGTGGG - Intergenic
959248174 3:103902647-103902669 TTTCCCAGGGTGTGGATGGAGGG + Intergenic
959289850 3:104459923-104459945 TTTTTTAGTGGGAGCATGGAGGG - Intergenic
960248810 3:115429171-115429193 TTTTGTAGGGGACGGGTGGTGGG + Intergenic
960996600 3:123344312-123344334 TTCTCTAGTTGGCGAATGGAGGG - Intronic
962677507 3:137767914-137767936 CTTCCTAGGGGGCGGGAGGAGGG - Intergenic
964185704 3:153940124-153940146 TTCTCTAGGCAGCTGATGGAGGG - Intergenic
970828079 4:20302460-20302482 ATGTCTATGGGGGGGATGGAAGG + Intronic
973650194 4:52991464-52991486 TGGGCTAGGGGGAGGATGGAAGG + Intronic
977077528 4:92474962-92474984 TTTTTTGGGGGGGGGGTGGAGGG + Intronic
977957418 4:103046057-103046079 TTTACTAGGGAATGGATGGAAGG + Intronic
978620488 4:110631580-110631602 TGTTCTATGGGGCGGAGGGGGGG - Intronic
978887469 4:113782294-113782316 TTTTTTAGGGGGAGGAATGAGGG - Intergenic
989188761 5:38649673-38649695 TTTTCTGGGGGGGGGATGGGGGG - Intergenic
991997164 5:72399658-72399680 TTTTCAAGTGGGCAGATGTAAGG + Intergenic
992120215 5:73585050-73585072 TATTCTAGGGGCTGGATTGAAGG - Intergenic
996015839 5:118533347-118533369 TTTTCGAGGAGGCTGTTGGATGG - Intergenic
996727646 5:126686762-126686784 TTTACTGGGGGGTGGATTGAGGG + Intergenic
998020629 5:138766893-138766915 TTTTTTAGGGGGCAGAGGGAAGG + Intronic
998512053 5:142721797-142721819 CTATCTAGGGTGTGGATGGATGG + Intergenic
999480159 5:151940845-151940867 TTTCCAAGGGGGAGGATGCAAGG + Intergenic
1000516493 5:162241493-162241515 TTTTATAGGCATCGGATGGAGGG + Intergenic
1002816615 6:686877-686899 ATTTGTTGGGGGTGGATGGAGGG - Intronic
1004924591 6:20404076-20404098 TTTTCTAGGGGGCGGATGGATGG + Intronic
1006082714 6:31576673-31576695 TGGTCTTGGGGGAGGATGGATGG + Intronic
1006107843 6:31727464-31727486 TTTCCTAGTGGGAGGAAGGAAGG - Intronic
1006303481 6:33206245-33206267 TTTTCTAGGGGACTGGTGGTTGG + Intronic
1006367066 6:33621946-33621968 CTTTGGAGGGGGCGGAGGGACGG + Intronic
1007006455 6:38368337-38368359 TTTTTTAGGGGGCGGGGGAATGG + Intronic
1008042545 6:46817058-46817080 TTTTCTAGGGGAAAAATGGAAGG + Intronic
1009668152 6:66709541-66709563 TTTTCTGGGGGGCGGGGGTAGGG + Intergenic
1010803821 6:80211643-80211665 TTTTCTAAAGGGTGGATGGGTGG - Intronic
1011118278 6:83920730-83920752 TTTTCTGGGGGGTGGGGGGAGGG + Intronic
1011433184 6:87309745-87309767 CTTTCTAGAGGGTGGATGCAGGG - Intronic
1016812170 6:148271924-148271946 TTTTGTAGGGGGCGGGAGAAAGG + Intergenic
1018989350 6:168661595-168661617 TTTTTTGGGGGGAGGTTGGATGG - Intronic
1021086708 7:16429234-16429256 TTTTCGTGGGGGAGGAGGGAGGG - Intergenic
1021896354 7:25239683-25239705 TTTTCTGGGGGGCGGGGGGTGGG + Intergenic
1022398252 7:30010284-30010306 TTTTCGAGGGGGAGGAGGGAGGG - Intergenic
1024010043 7:45259446-45259468 TTTTCTAGGGAGCAGCAGGATGG - Intergenic
1025818765 7:64944460-64944482 TTTTCGGGGGGGCGGGGGGATGG - Intergenic
1028776759 7:94685811-94685833 CTGTTGAGGGGGCGGATGGAGGG + Intergenic
1032155377 7:129463469-129463491 TTTTCAAAGGGGAAGATGGAAGG - Intronic
1032742004 7:134748705-134748727 TTTTTTGGGGGGCGGGGGGATGG - Intronic
1034432309 7:151047205-151047227 TTCTCTAGGGGGCGGGTGAAGGG - Intronic
1037139696 8:15505109-15505131 TATTCCAAGTGGCGGATGGAGGG - Intronic
1038598571 8:28913872-28913894 TTTTTGCGGGGGCGGAGGGATGG + Intronic
1043099101 8:76017438-76017460 TTTTCTTTGGGGAGCATGGATGG + Intergenic
1044740321 8:95319881-95319903 TTTTTTGGTGGGGGGATGGAGGG - Intergenic
1048226555 8:132592857-132592879 ATTTCAAGTGGGCGGATGAAAGG + Intronic
1048348692 8:133598166-133598188 TTTTTTGGGGGGCGGGGGGACGG - Intergenic
1052904627 9:33822805-33822827 TTTTTTAGGGGGAAGAGGGAAGG - Intronic
1053504634 9:38631164-38631186 TTTTTTTGGGGGGGGATGGGGGG + Intergenic
1056177316 9:84048110-84048132 TTTTCTGGGGGGAGGGGGGAGGG + Intergenic
1191033512 X:56000469-56000491 TTTTCTTGGGGGGGGGGGGAGGG + Intergenic
1191215707 X:57930632-57930654 TTTTCTGGGGAGTGGAGGGAAGG + Intergenic
1191671863 X:63755377-63755399 GCTTCTTGGGGGCGGATAGAGGG + Intronic
1193667319 X:84337920-84337942 TTTTTTAAGGGGCTGGTGGAGGG - Intronic
1197150524 X:123215731-123215753 TTTTCTGGGGGGCAGAGAGATGG + Intronic
1200176513 X:154120932-154120954 TTTTTTAGGGGGAGGGGGGAAGG + Intergenic
1201917593 Y:19198987-19199009 TTTCCTAGGGGCTGGAAGGAAGG - Intergenic