ID: 1004933351

View in Genome Browser
Species Human (GRCh38)
Location 6:20483303-20483325
Sequence TTGGCTTCCCAGATTTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 227}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004933351 Original CRISPR TTGGCTTCCCAGATTTTTGG TGG Intronic
900138892 1:1130824-1130846 TTGTCTTCTCAGTGTTTTGGTGG + Intergenic
900857377 1:5196872-5196894 TGGCTTTCCCAGATATTTGGCGG + Intergenic
901941205 1:12663294-12663316 TTGATTTCTCAGAGTTTTGGAGG + Intronic
903119727 1:21207671-21207693 TTGGCCTCCCAAAGTGTTGGGGG + Intergenic
903542470 1:24104798-24104820 TTGGCTTCCCAAAGTGCTGGAGG + Intronic
905960636 1:42039693-42039715 GTGGTTTCCCAAATTTTTTGGGG - Intergenic
907252950 1:53155198-53155220 TTGGCTTCCCAGCTTTCAGCAGG - Intergenic
908844712 1:68312817-68312839 TTGGCTTCTTTGAGTTTTGGAGG - Intergenic
912636464 1:111298774-111298796 TTGGATTCACTGATTTTTTGAGG - Intronic
913177457 1:116287949-116287971 TTGGCTTCCAGGACTTTTGCAGG - Intergenic
916570396 1:166020595-166020617 TTGGCTTTCTAGATATTTAGAGG - Intergenic
916895457 1:169157571-169157593 TTGATTACCCAGATTTTTTGGGG - Intronic
917216202 1:172680813-172680835 TGTGCTTCCCAGACTTCTGGAGG + Intergenic
918696652 1:187553505-187553527 TTGGCTTCAGATTTTTTTGGTGG - Intergenic
919699055 1:200612457-200612479 TTGGCTCTCCAGATTTTAGAGGG - Intronic
920986443 1:210894805-210894827 TGGGCTTCCCAGCTTTCTGGAGG + Intronic
922008744 1:221559380-221559402 TTGGCTTTCCAGGTTCTTGCTGG - Intergenic
922080369 1:222289933-222289955 TAGGCTTCCCAGTTTCTGGGTGG - Intergenic
922223424 1:223626136-223626158 ATGACTTCCCAGTTTCTTGGTGG - Intronic
923525644 1:234770463-234770485 CTGGCTTCCCAGACGTTTGGAGG + Intergenic
923563251 1:235057739-235057761 TTGTCTTCCTACATTGTTGGAGG + Intergenic
924294991 1:242577582-242577604 TTGGCTTGCCATAATTTTGGAGG + Intergenic
924799402 1:247316619-247316641 TTGACTTCTCATATTTATGGAGG - Intronic
1063741531 10:8827145-8827167 TTGGCTGCACAGATTTTAAGAGG + Intergenic
1065656060 10:27951476-27951498 GTGGTATCCCAGATTATTGGAGG + Intronic
1065958583 10:30714862-30714884 TTGGCTTCTCTCATTTTGGGTGG - Intergenic
1066183108 10:32982350-32982372 TTGGCCTCCCAAAATTCTGGGGG + Intronic
1068239914 10:54291508-54291530 CTGGATTCACTGATTTTTGGAGG - Intronic
1069135132 10:64754379-64754401 TTTGTTTCCCACAGTTTTGGAGG - Intergenic
1070964557 10:80521617-80521639 ATGGCTCCCCAGATTTCTGGAGG - Exonic
1072329301 10:94330884-94330906 TTTGCTACCCAGATTTCTGGTGG - Exonic
1073309215 10:102527817-102527839 CTGGCTTCCCAGAGTTCTGGAGG + Intronic
1073757411 10:106595437-106595459 ATGGCTTCCCAGACCTTTGATGG + Intronic
1074957442 10:118406158-118406180 TTGGCTTCCCAGGTCTGTGAAGG + Intergenic
1075089755 10:119437057-119437079 TTGGCTTCCCTAAACTTTGGAGG - Intronic
1075803496 10:125168087-125168109 TGGGCTTCCCAGATTTTCCCTGG + Intergenic
1079295920 11:19233895-19233917 TCGGCCTCCCAAATTTTGGGAGG - Intronic
1079972304 11:27050323-27050345 TTGGCCACTCAGATTTTTTGTGG + Intronic
1080294678 11:30713118-30713140 TTTTCTTTCCAGATGTTTGGTGG + Intergenic
1080317143 11:30963048-30963070 TTGGTATCTCAGATATTTGGTGG + Intronic
1082874741 11:57977039-57977061 TTGGCTTGCTAGGATTTTGGAGG + Intergenic
1084993371 11:72950756-72950778 TTGGCTTCTCAGATATTTAGAGG + Intronic
1086040303 11:82468715-82468737 TTGGCTTCTCAAACTTTTTGAGG - Intergenic
1086393360 11:86389031-86389053 TTGCAATCCCAGAATTTTGGAGG + Intronic
1088849650 11:113694601-113694623 CTGGCTTCCCGGATAGTTGGTGG - Exonic
1088979006 11:114844427-114844449 TTGGTGTCCCAGCTTTTTGTGGG + Intergenic
1089307326 11:117534867-117534889 CTGGCATCCCAGCTCTTTGGAGG - Intronic
1090695845 11:129240914-129240936 TTGGATTCCCAGATTTCTCCAGG - Intronic
1093588431 12:20870860-20870882 TTCTATTCCCAGATTTTTGAGGG + Intronic
1093701326 12:22225174-22225196 TTGTTTTCTCAGAATTTTGGAGG - Intronic
1094411191 12:30170159-30170181 GTGGGTTCCCAGTTTTTTGGGGG - Intergenic
1094593446 12:31842682-31842704 TTGTAATCCCAGAATTTTGGGGG + Intergenic
1095547493 12:43388804-43388826 TTTACTTCCCACAATTTTGGAGG + Intronic
1095694824 12:45132586-45132608 ATGGCTTCCCAGTTTTGTGCTGG - Intergenic
1095901850 12:47335843-47335865 TTGGCCTCCCAAAGTGTTGGTGG - Intergenic
1096156559 12:49344730-49344752 TTGTCTTCCTACATTTTGGGGGG + Intergenic
1098766586 12:74497827-74497849 TTGGCTTCCCACAGTTCTGGAGG - Intergenic
1099665802 12:85627328-85627350 TTGGCTTACTAGATTTGTGTGGG - Intergenic
1100862934 12:98826443-98826465 TCTGCTTACCAGATGTTTGGAGG - Intronic
1101457331 12:104848182-104848204 TTTACTTTCCAGATATTTGGGGG - Intronic
1102475266 12:113184843-113184865 TTCGTTTCCCAGAGGTTTGGAGG + Intronic
1103919051 12:124390013-124390035 TCTGCTCCCCAGATTTTTAGGGG - Intronic
1104204204 12:126620861-126620883 TTGTCTTCTCAGTTATTTGGAGG + Intergenic
1104337433 12:127912670-127912692 TTGGCTGCCCAGGTTTTGGGGGG + Intergenic
1105315982 13:19263863-19263885 TCGACTTCCCAGGTTTATGGTGG - Intergenic
1106015645 13:25866580-25866602 TTGCCTGCACATATTTTTGGGGG - Intronic
1107998801 13:45888003-45888025 CTGGCTTCCCATATTCTTTGGGG + Intergenic
1108812289 13:54242507-54242529 TAGGCTTTGCATATTTTTGGAGG + Intergenic
1110233269 13:73189333-73189355 TTGGCTTTTCAAATTTTGGGGGG + Intergenic
1111864302 13:93749742-93749764 TTGGCTTCTTGGCTTTTTGGGGG - Intronic
1112371932 13:98801961-98801983 TTGGTTTCACAGATTTTAAGTGG + Intronic
1113116304 13:106877977-106877999 TTTACCGCCCAGATTTTTGGTGG + Intergenic
1113211052 13:107981785-107981807 TTGGCGTCCCAGTTTTTGAGAGG - Intergenic
1119221946 14:72915988-72916010 AGGGCTTCCCTGAATTTTGGAGG - Intergenic
1121888443 14:97566508-97566530 TCTGCTTCCTAAATTTTTGGTGG - Intergenic
1127433506 15:58934408-58934430 TTGGAATCCCAAATTTTGGGGGG - Intronic
1129412074 15:75355702-75355724 ATGGCTTCCCAGGTATTTGGTGG - Exonic
1129833988 15:78690454-78690476 TTGGCTTGCCAGATCTTGGGAGG - Intronic
1130305267 15:82709231-82709253 TTGGCTTCCCAAAAATGTGGGGG - Intronic
1131203930 15:90425550-90425572 ATGAATTCTCAGATTTTTGGAGG - Intronic
1131316580 15:91343810-91343832 TTTGCTTCTGAGATTTTTGAGGG + Intergenic
1132567882 16:631505-631527 TGGGCTCCCCAGACTTCTGGGGG + Intronic
1135982626 16:27160086-27160108 CTGGCCTCCCAAATTTGTGGTGG - Intergenic
1138789458 16:59886028-59886050 TTGGCTTCTTAGATTTTTATGGG - Intergenic
1141465459 16:84203086-84203108 TTGGCCTCCCAAAGTTCTGGGGG - Intergenic
1141700986 16:85641924-85641946 CTGGGTTCCCAGGTTTTGGGTGG + Intronic
1142794543 17:2297407-2297429 TTGTCTGCCCCGGTTTTTGGTGG - Intronic
1144296013 17:13875820-13875842 TTGGATTCCCTTGTTTTTGGAGG + Intergenic
1145879052 17:28340695-28340717 TTTGCTACCCGGATTTTAGGGGG + Intronic
1146809248 17:35890309-35890331 TTGGGATCCCAGATTTCTAGAGG - Intergenic
1147928841 17:43963713-43963735 TCGGCTTCCCAAAGTGTTGGGGG - Intronic
1151007257 17:70451909-70451931 CTGGATTCCTAGGTTTTTGGGGG + Intergenic
1152375850 17:79918585-79918607 CTGGCTTCCCAGAAGTTGGGAGG + Intergenic
1154936536 18:21063617-21063639 TTCCATTCCCAGCTTTTTGGTGG - Intronic
1156581091 18:38376162-38376184 TTTGTTTTCCAAATTTTTGGAGG - Intergenic
1156941525 18:42772804-42772826 TTCCCTTCCCAGAGTTTCGGGGG - Intronic
1157330038 18:46697043-46697065 TTGGCTGCCATGGTTTTTGGTGG - Intronic
1157434074 18:47653813-47653835 TTGGCTGTCCAGATAATTGGGGG + Intergenic
1159156748 18:64593067-64593089 TTTGCTTCCCACAGTTTTGGAGG + Intergenic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1160296282 18:77640282-77640304 CTGGATTCCCTGATTTTTGAAGG - Intergenic
1160375141 18:78405918-78405940 TCGGCTTCCCAGATCATTCGGGG + Intergenic
1165077096 19:33285917-33285939 TTGGAATCCCAGCTTCTTGGGGG - Intergenic
1166437947 19:42785518-42785540 TTTGTTTGCCAGATTTCTGGTGG - Intronic
1166472984 19:43096257-43096279 TTTGTTTTCCAGATTTCTGGTGG - Intronic
1166493765 19:43283243-43283265 TTTGTTTTCCAGATTTCTGGTGG - Intergenic
1167137767 19:47627670-47627692 ATGGCTTTAGAGATTTTTGGAGG + Intronic
1168222192 19:54968579-54968601 TTGGCTTCCCAAAGTGTTTGGGG + Intronic
1168518488 19:57029183-57029205 TTGGTTTTCCTAATTTTTGGGGG - Intergenic
925010329 2:480117-480139 CTTGATTCCCAGATATTTGGGGG - Intergenic
925499843 2:4490498-4490520 GTGCCTTCCCAGATTTCCGGTGG + Intergenic
925714014 2:6768381-6768403 ATGGCTTCCCAGATGTCAGGGGG + Intergenic
926761682 2:16283933-16283955 TTGGCAACCCAGAATTTCGGTGG - Intergenic
927574122 2:24186886-24186908 TTGGCTTCCCAGAGTACTGGGGG + Intronic
928714210 2:34041894-34041916 TTCTCTTCCCAGATTTATGGAGG - Intergenic
931675472 2:64691529-64691551 TTTGTTTCATAGATTTTTGGGGG + Intronic
932628678 2:73319705-73319727 TAGGCATCCCAGATATATGGTGG + Intergenic
932757459 2:74418197-74418219 TTTCCTTCCCAGAGTTGTGGTGG + Intronic
933118380 2:78502553-78502575 TTGTCTTCTTAGATTTTTGTTGG - Intergenic
933207474 2:79523815-79523837 TTTGTTTCCCAGATTTCTAGAGG + Intronic
933446255 2:82383443-82383465 TTGGCTACCCAGATTGAGGGTGG + Intergenic
933978548 2:87531339-87531361 TTGGCTTCCAAGCTTCATGGAGG + Intergenic
935244617 2:101207302-101207324 TTGGCTTCCCAAAGTGCTGGGGG + Intronic
935300877 2:101693044-101693066 TTGGCTCCCCAGAGTTTGGATGG - Intergenic
935500103 2:103828977-103828999 TTGTCTTCCCTGATTTTTGTTGG + Intergenic
936315285 2:111419463-111419485 TTGGCTTCCAAGCTTCATGGAGG - Intergenic
936809760 2:116384037-116384059 TTAGCTTCCTAGGTCTTTGGGGG + Intergenic
938920546 2:135990554-135990576 TTGGCTTCCTGCATTTTTGGGGG + Intergenic
940448131 2:153802936-153802958 TTGGCCTCACATATTTTTAGAGG + Intergenic
941623051 2:167800302-167800324 TTGGGGTTCCAAATTTTTGGAGG - Intergenic
941650531 2:168087633-168087655 TTGGCTTACTTGATTTATGGGGG - Intronic
942689158 2:178566945-178566967 GTGACTTCCAAGCTTTTTGGTGG + Exonic
942832318 2:180251763-180251785 TTGACTTCTCACACTTTTGGTGG + Intergenic
943548978 2:189315171-189315193 TTGGCTTGCCAGTATTTTGTTGG - Intergenic
943743832 2:191440280-191440302 TTTGCTTTCCAGGCTTTTGGGGG - Intergenic
946723052 2:222631818-222631840 TTGGCCTCCCAGAGTGCTGGTGG - Intronic
947368824 2:229424469-229424491 TTATTTTCCCAGAGTTTTGGAGG + Intronic
948511957 2:238474254-238474276 TTGAGTTCCAAGATTTTTTGGGG + Intergenic
1169039003 20:2477389-2477411 CTGACTTCCCAGATTTTTACTGG + Intronic
1169565995 20:6854268-6854290 TTGCCATCCAAGTTTTTTGGGGG - Intergenic
1173461004 20:43243368-43243390 TGGGATGCCCAGAGTTTTGGGGG - Intergenic
1173531777 20:43775185-43775207 TTGGATAGCCAGTTTTTTGGTGG + Intergenic
1175395347 20:58654841-58654863 TTTGCTTCCTCTATTTTTGGAGG - Intronic
1178743065 21:35221572-35221594 TTACCTTCCCAGCTTTTTGCAGG - Intronic
1182729296 22:32474618-32474640 CTGGCATCCCAGATTTTCCGCGG - Intergenic
1183430415 22:37762453-37762475 TTGGCTTCTCAGCTTACTGGTGG + Intronic
1183966439 22:41445617-41445639 TTCCCCTCCCAGATTTCTGGTGG + Intronic
1184541220 22:45126594-45126616 TTGGTTTCTCAGAGTTCTGGAGG + Intergenic
1184923239 22:47620346-47620368 TTGGTTTCCCACAGTTCTGGAGG - Intergenic
950677136 3:14561132-14561154 TGTGCTCCCCAGATTTTTGCAGG + Intergenic
951590221 3:24256374-24256396 TTGGCTTCCCAGTCTTTGGCTGG - Intronic
953716099 3:45318288-45318310 TTGGCCTCCCAAATTATTGCTGG - Intergenic
955013174 3:55040010-55040032 TTTATTTCCCACATTTTTGGAGG + Intronic
957228860 3:77485446-77485468 TTTTCTTCCCAAATGTTTGGTGG + Intronic
958847942 3:99288060-99288082 TTGTCTTTCCAGATTTAGGGTGG - Intergenic
959335091 3:105054329-105054351 TTTTCTTGCCACATTTTTGGTGG - Intergenic
960143959 3:114179182-114179204 TTGCCTTTCCAGATTTTGGTGGG + Intronic
960352510 3:116610440-116610462 TTGGTTTCCAGAATTTTTGGGGG - Intronic
961002055 3:123380527-123380549 TTGCCTGCCCTGATTTTAGGAGG - Intronic
963692635 3:148523965-148523987 TTCTCTTCCCAGTTTTTTGAGGG - Intergenic
964890323 3:161526978-161527000 TTTGCTTCTCAGATTGCTGGAGG + Intergenic
965470668 3:169086595-169086617 TTGGCCTCCAAGAGTTGTGGAGG + Intronic
965653468 3:170958511-170958533 TTATCTTCCCAGATTTGTAGTGG - Intergenic
967367679 3:188706230-188706252 TAGCCCTCCCTGATTTTTGGGGG + Intronic
969433197 4:7168075-7168097 TTGGCTTCCCAGAATGTTGCAGG + Intergenic
970810906 4:20093038-20093060 TTTTCTTCTCAGAGTTTTGGAGG - Intergenic
971006434 4:22379080-22379102 CTGGATTCCCTGATTTTTGAAGG + Intronic
972973997 4:44610888-44610910 TTTGCTTCCTATATTTTAGGTGG - Intergenic
973727457 4:53790404-53790426 TTGGCTTCACAGATTAGTGTTGG + Intronic
973798130 4:54449594-54449616 TTGGAGTCCCAGATTGTTGCGGG + Intergenic
974901102 4:67999236-67999258 TTGGCTTTTCACATTTTTTGGGG + Intergenic
977066545 4:92323600-92323622 CTGGCATCCCAGGTTTTTTGTGG + Intronic
977664805 4:99633800-99633822 TTGTCTTCCAATATTCTTGGAGG - Intergenic
978715931 4:111842286-111842308 TGTGCTTCTCAGAGTTTTGGAGG + Intergenic
979086628 4:116418971-116418993 TTAGTTTTCCACATTTTTGGAGG - Intergenic
979217448 4:118182461-118182483 GAGGCATCCCAGATTTTTTGTGG - Intronic
981092791 4:140749376-140749398 TTGCCTTCCTTGCTTTTTGGTGG - Intronic
981164673 4:141543236-141543258 ATGGCTTTCCTGATTTTTGTAGG + Intergenic
983493246 4:168413034-168413056 AAGGCTTCCCAGGTATTTGGAGG - Intronic
985512133 5:318885-318907 TTGGCTTCACAGAAGTGTGGGGG - Intronic
986173339 5:5331521-5331543 CTGGCATCTCAGAATTTTGGAGG - Intergenic
987163354 5:15168432-15168454 TTGGGGTCCCAGCTTTATGGGGG + Intergenic
987970218 5:24932858-24932880 TTGAATTCCCAGTTTCTTGGTGG + Intergenic
989326817 5:40206194-40206216 TTGGCTTTGCAGATTTTGGCTGG - Intergenic
994729854 5:103479013-103479035 GTGTCTTTCCAGTTTTTTGGGGG - Intergenic
995404912 5:111784095-111784117 TTGAATTCCCAGATTATTTGTGG - Intronic
995563945 5:113413726-113413748 TTGGATTCACTGATTTTTGAAGG + Intronic
996237092 5:121143556-121143578 TTGGGTTCCCAGATTTCCTGGGG - Intergenic
998529044 5:142868373-142868395 ATGGCTTCCCAGAGCTCTGGAGG - Intronic
999599163 5:153241643-153241665 ATGACTTCCCATATTGTTGGTGG + Intergenic
1000172667 5:158718402-158718424 TTGCCTTCCCCTTTTTTTGGAGG + Intronic
1000284467 5:159815148-159815170 ATGGCTTCCCAGAGTCTTGGGGG + Intergenic
1003214665 6:4098426-4098448 TCGGCCTCCCAAATTTTGGGAGG + Intronic
1003230630 6:4249751-4249773 TTGGAGTCTCAGCTTTTTGGGGG + Intergenic
1003765417 6:9230892-9230914 TTGACTTCCCACATTTTTTAGGG + Intergenic
1004086561 6:12455087-12455109 TTTGTTTCCCACATTTCTGGAGG - Intergenic
1004933351 6:20483303-20483325 TTGGCTTCCCAGATTTTTGGTGG + Intronic
1006109518 6:31736217-31736239 TTGGCTTCCAGGAATTTGGGTGG + Intronic
1006736420 6:36276696-36276718 TTGGCTTGCCAGTTTTTTATGGG - Intronic
1007644767 6:43371241-43371263 TTGGTTACCCATACTTTTGGTGG + Intergenic
1010202380 6:73294029-73294051 TTGGCTTCCCAAATGGCTGGTGG - Intronic
1010209607 6:73352751-73352773 CTGACTTCCCATATTTTTGTTGG + Intergenic
1011518822 6:88182066-88182088 TTAGTTTCCCAGAAATTTGGAGG + Intergenic
1011645173 6:89450751-89450773 TTGGCCTCCCAGAGTGCTGGGGG + Intronic
1011825876 6:91304765-91304787 TGGGCTTCCCATATTCTTGGTGG - Intergenic
1012112338 6:95252422-95252444 TTGCATTCCCAGCTATTTGGGGG - Intergenic
1016301502 6:142636664-142636686 TTAATTTCCCATATTTTTGGGGG + Intergenic
1016748363 6:147605839-147605861 TTGGCTTCCCAGCTTAAAGGAGG - Intronic
1018924056 6:168194449-168194471 TTTCCTTCCCACATTTCTGGAGG + Intergenic
1019400664 7:851238-851260 TTGGCTTTTCATATTTTTTGAGG + Intronic
1019903202 7:4040720-4040742 GTGGGTGGCCAGATTTTTGGAGG - Intronic
1020149067 7:5667657-5667679 TGGGCTTCCCAGGGTTTTGCTGG + Intronic
1020366398 7:7385200-7385222 TTGTTTTCTCAGATTTTTTGTGG + Intronic
1024407730 7:49001887-49001909 ATGGCTTCCCAGAGTCTTGCTGG + Intergenic
1024489721 7:49966548-49966570 TTTAATTTCCAGATTTTTGGGGG - Intronic
1024862776 7:53864809-53864831 TTTCCTTGCCAGTTTTTTGGGGG - Intergenic
1026297049 7:69062196-69062218 CAGGCTGCCCAGATATTTGGTGG - Intergenic
1030081542 7:105782815-105782837 TTTGCTTCCCACACTCTTGGAGG - Intronic
1030870267 7:114747188-114747210 TTGGAGTCACAGATATTTGGAGG - Intergenic
1034311748 7:150094813-150094835 TTTGCATCCCAGAGTGTTGGCGG - Intergenic
1034795105 7:154005841-154005863 TTTGCATCCCAGAGTGTTGGCGG + Intronic
1034909987 7:154987984-154988006 TTGGTTTCCCAAATTTTCTGAGG + Intronic
1035201333 7:157268668-157268690 TTGTCTTCCTGGATATTTGGGGG + Exonic
1038854567 8:31317317-31317339 TTGGCTTCCCAGTTTATAGATGG - Intergenic
1039841229 8:41294633-41294655 CTGGCTTGGCAGATATTTGGAGG - Intronic
1042632490 8:70833835-70833857 TTGGCTTCTATGTTTTTTGGAGG - Intergenic
1043984484 8:86677676-86677698 TTACCTTCCCTGATTTTTTGTGG - Intronic
1045351344 8:101343157-101343179 TTGGCTGCCGGGATTTTAGGAGG + Intergenic
1045608909 8:103811918-103811940 GTGGCTTCACACATTTGTGGTGG + Intronic
1046534414 8:115490788-115490810 ATGTTTTCCCAGAATTTTGGAGG + Intronic
1046846062 8:118917650-118917672 TTTACTTCCCACATTTCTGGAGG - Intergenic
1049798569 8:144507423-144507445 CTGGCTCCCTAGATTCTTGGGGG - Intergenic
1051621557 9:19055181-19055203 TTTCCTTGCCAGTTTTTTGGGGG + Exonic
1052543649 9:29844435-29844457 TTGGCTTGCTAGTATTTTGGGGG - Intergenic
1053053092 9:34977471-34977493 TGGGCTTACCAGAGTTTGGGAGG + Intronic
1054821485 9:69525498-69525520 ATGTATTCCTAGATTTTTGGGGG - Intronic
1055465421 9:76560780-76560802 TTGGCTTCCCAAATGGGTGGAGG + Intergenic
1056252797 9:84767783-84767805 TCGAATTCCCAGATATTTGGGGG - Intronic
1057121081 9:92574320-92574342 TTGTTTTCACAGGTTTTTGGGGG - Intronic
1058394720 9:104537988-104538010 TAGGTTTCCCAGATGTTTGCCGG - Intergenic
1186124599 X:6399506-6399528 TTGGCTTTCCTGATTTTGGAAGG - Intergenic
1193730471 X:85096699-85096721 TTGGCTTCCAAGGTTTCTGATGG - Intronic
1195870932 X:109484850-109484872 CTGGCTTCACAGTTTTGTGGAGG - Intergenic
1196457887 X:115902885-115902907 TTGGCTTCCCAGATTTTAGCAGG + Intergenic
1196463607 X:115952238-115952260 TTGGCTTCCCAGACTTCAGCAGG + Intergenic
1196653344 X:118191020-118191042 TTGGCTTCCAGAGTTTTTGGTGG - Intergenic
1197398087 X:125952501-125952523 TTGTTTTTCCAGATTTCTGGTGG + Intergenic
1200964074 Y:9020480-9020502 TTTGTTTCCCAAACTTTTGGTGG - Intergenic
1200981887 Y:9270043-9270065 TGAGTTTCCCAGCTTTTTGGTGG - Intergenic