ID: 1004933744

View in Genome Browser
Species Human (GRCh38)
Location 6:20487487-20487509
Sequence GAATAGTATTCTTAAGTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004933744_1004933745 18 Left 1004933744 6:20487487-20487509 CCTAGCACTTAAGAATACTATTC 0: 1
1: 0
2: 0
3: 5
4: 139
Right 1004933745 6:20487528-20487550 ATGAAAAAGTCCTACCATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004933744 Original CRISPR GAATAGTATTCTTAAGTGCT AGG (reversed) Intronic
901179101 1:7327966-7327988 GACTAATATTTTCAAGTGCTGGG - Intronic
902200896 1:14832763-14832785 GAATAGCATTCTTAGGTTGTGGG - Intronic
902921213 1:19666781-19666803 GAAAAGTATTCCTAAGTTCCTGG - Intronic
904574278 1:31492954-31492976 GAATAGTATTCACAACTGTTGGG - Intergenic
906541496 1:46590002-46590024 GAAAAGAATTCTGAAGTGGTTGG - Intronic
908264309 1:62363157-62363179 GACTATTATTGTTATGTGCTGGG + Intergenic
909524645 1:76609079-76609101 AAATAGTTTTCTCAAGTGCTGGG - Intronic
909857508 1:80556768-80556790 AAGTTGTATTCTTAATTGCTTGG - Intergenic
910730114 1:90385970-90385992 GAATAGTATGCTCATGAGCTTGG + Intergenic
917414503 1:174795018-174795040 GAAGAGCATTCTCAAGTGCAAGG + Intronic
920124196 1:203680646-203680668 GAATAGGACACTTAAGTGATGGG - Intronic
923393634 1:233538457-233538479 GAATGGTATTTTGAAGTGATAGG + Intergenic
924190121 1:241542304-241542326 AAATAATATTTTTAAGTGGTAGG + Intronic
1063734069 10:8732578-8732600 GGTTATTATTCTTAACTGCTAGG + Intergenic
1064567439 10:16656178-16656200 TAATAGTTTTCTTAAGTGGTAGG - Intronic
1065349384 10:24782092-24782114 GAATTGTATTCTTAGGGGCAGGG - Intergenic
1065928175 10:30454780-30454802 GTAAAGTATTCTTAAGATCTGGG - Intronic
1066196320 10:33103906-33103928 GAATAGAATTATTAAGTGAAAGG + Intergenic
1067934674 10:50599445-50599467 GAATATGACTGTTAAGTGCTGGG + Intronic
1067950613 10:50734252-50734274 AAATATTATTCATAAGTGATTGG - Intergenic
1072095620 10:92176531-92176553 GAATAGTATCATTCAGTTCTAGG - Intronic
1075365018 10:121878906-121878928 TAATGGTATTGTTAAGTCCTTGG - Intronic
1078300978 11:10132100-10132122 GAATAGTATTCTTCAGAAGTGGG - Intronic
1078356747 11:10637795-10637817 GAACAGTATTCACAAGGGCTGGG + Intronic
1080925136 11:36748342-36748364 GAATAGTCTTTTTAGGTGTTGGG + Intergenic
1081178409 11:39957735-39957757 GAATCTTATTCTTAAGTTTTCGG - Intergenic
1087487184 11:98770846-98770868 AAATAATATTCTTAACTTCTGGG + Intergenic
1087523169 11:99270107-99270129 GAACAGTGTTTTTAAGGGCTTGG - Intronic
1087992350 11:104760105-104760127 GTATAGTATTCTTGAGTGGCAGG - Intergenic
1088141825 11:106626009-106626031 TTATAGTATTCTTATGTGATAGG - Intergenic
1093229680 12:16528423-16528445 TAATAATATTCTTAAGAGCACGG - Intronic
1093839897 12:23884662-23884684 GAGCAGAATTATTAAGTGCTTGG + Intronic
1095126486 12:38484389-38484411 GAATGATATTCTTAAGGGCAAGG + Intergenic
1095588442 12:43874989-43875011 GATAAGTATTCTTAAGTTCAGGG + Intronic
1101871424 12:108568750-108568772 GAATAGAATCTTTAAGAGCTGGG - Intronic
1104525658 12:129518786-129518808 AATTAGAATCCTTAAGTGCTAGG - Intronic
1108184675 13:47876810-47876832 GTCTAGTATTCCTAAGTGCAAGG + Intergenic
1108205706 13:48087437-48087459 TAAAAGTTTTCTTAAGTTCTTGG - Intronic
1108539642 13:51428127-51428149 GTAAAGTATTCTTATGTGCGAGG - Intronic
1108570668 13:51746635-51746657 TAATAGTTTTCTTAAATTCTGGG + Intronic
1110615322 13:77535156-77535178 GATTAGAATTCTTACATGCTAGG + Intergenic
1110667166 13:78131013-78131035 TAATAGTGTTCTTAATAGCTAGG + Intergenic
1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG + Intronic
1112656793 13:101460237-101460259 AGATAATATTCTTACGTGCTTGG - Intronic
1115348382 14:32366519-32366541 CAATAGTATTCTAAAGACCTTGG - Intronic
1115796934 14:36948101-36948123 GAATTGCATTCTTAAGAACTAGG - Intronic
1116499505 14:45603461-45603483 GCATAGTTTTCTTTATTGCTAGG + Intergenic
1117420202 14:55537123-55537145 GAATAGTATTCTATTGTGCGGGG - Intergenic
1118299908 14:64606038-64606060 GCATGGTATGCTTAACTGCTTGG - Intergenic
1119073381 14:71609899-71609921 GAATAATATTTTAAAGTGCATGG + Intronic
1120485245 14:85104777-85104799 GATTAGTATTCTCAAGTGAAAGG + Intergenic
1128022407 15:64403452-64403474 TAATAGTGTCCTTAACTGCTGGG - Intronic
1130006885 15:80108097-80108119 GATTGGTATTTATAAGTGCTTGG + Intronic
1131890549 15:96967364-96967386 GAATAGTATTCCCAAGTATTTGG + Intergenic
1132401949 15:101515527-101515549 GAATAATTTTTTTAAGTTCTGGG - Intronic
1134474015 16:14555501-14555523 GAATAGTATGCTTAAGTTAATGG - Intronic
1139258945 16:65573572-65573594 GAAGGGTTTTCTTAGGTGCTTGG + Intergenic
1139791967 16:69445287-69445309 AAATAGCATTCTTAAATACTGGG + Intronic
1144720310 17:17464664-17464686 GAACGGTATTCTCAAGTGCACGG + Intergenic
1148081611 17:44970164-44970186 GAAGAGTAGTCTTCAGCGCTCGG + Intergenic
1148166601 17:45488459-45488481 GTATACAACTCTTAAGTGCTGGG + Intronic
1149278137 17:55068243-55068265 GAGAAGTATTCTTTAGGGCTTGG + Intronic
1149332687 17:55602933-55602955 GAGTAGTATTTTTAAGTATTGGG - Intergenic
1149388128 17:56162591-56162613 GAATTATATTCTGAAGTACTGGG + Intronic
1149899602 17:60462211-60462233 TAATAGAATTTTTAAGTACTTGG - Intronic
1150397775 17:64834860-64834882 GTATACAACTCTTAAGTGCTGGG + Intergenic
1155894032 18:31301073-31301095 AAATAATGTTCTTAAATGCTAGG - Intergenic
1159434598 18:68399493-68399515 GTATAATATTCTTAAGAACTTGG - Intergenic
935728941 2:106048912-106048934 TTATAGTATTCTTACCTGCTGGG + Intergenic
936953114 2:117998074-117998096 CAATATTTTTCTTGAGTGCTAGG - Intronic
938931912 2:136094156-136094178 GATTAAGATCCTTAAGTGCTGGG + Intergenic
939709465 2:145498494-145498516 GAATAGCATTCTGAAGTGAAGGG - Intergenic
940044623 2:149396344-149396366 GAAGAGCATTCTGAAGTTCTTGG - Intronic
942754484 2:179323578-179323600 GAATACTATTCTTTATTGCTAGG + Intergenic
943019715 2:182557770-182557792 GAATAATATTCTTCTGTGCATGG - Intergenic
945792631 2:214324473-214324495 GGAAAGTCTTCTTAAGTCCTAGG - Intronic
946727753 2:222678135-222678157 GCATAGGAATCTTAAGTGATTGG + Intronic
1169618733 20:7480315-7480337 TAATAGTATTATTAAATCCTTGG - Intergenic
1172090172 20:32425425-32425447 AAATTGTATTCTCAAATGCTTGG + Intronic
1174527474 20:51185169-51185191 GAAGGGTATTTTGAAGTGCTTGG + Intergenic
1177386430 21:20414977-20414999 TAATTCTATTCTTAAGTTCTGGG - Intergenic
951120651 3:18923370-18923392 TTATAGTATTTTTAAGTTCTAGG - Intergenic
954968699 3:54633819-54633841 GAATAACATCCTTAAGTGGTTGG - Intronic
959381310 3:105644404-105644426 GAATAGTATTATAAATTTCTTGG + Intergenic
959470702 3:106746246-106746268 GAGAAGTATTGTTTAGTGCTAGG - Intergenic
960067515 3:113389920-113389942 GATTGGTATTCTTAAATGTTTGG - Intronic
960213273 3:114997720-114997742 GATTAGTCTTTTTAAGTGGTAGG + Intronic
960878391 3:122319442-122319464 GAATATTGTTCTTAAGGGCAAGG + Intergenic
964220473 3:154338872-154338894 GAATAGTATTCTTTATTATTGGG - Intronic
968111709 3:196053745-196053767 GAATGGTTTTCTTACATGCTGGG - Intronic
969951608 4:10842465-10842487 GAATAATATTCTTATGACCTTGG - Intergenic
971015487 4:22485019-22485041 GACTAATTTTCTTAAGTCCTTGG + Intronic
973001096 4:44951695-44951717 GATTATTACTCTTAAATGCTGGG + Intergenic
975056636 4:69940985-69941007 GAAAAATATTCTCAATTGCTTGG - Intronic
976585306 4:86790839-86790861 AAATTGTATTCTTAAATGGTCGG - Intronic
977893151 4:102335119-102335141 GAATAATATACTTACGTTCTGGG + Intronic
980430941 4:132694032-132694054 GAATAATTTTATTAAATGCTTGG - Intergenic
981976584 4:150737230-150737252 GGATAGAATTCTTAGGTGGTTGG - Intronic
985112748 4:186563095-186563117 GTATAGAATTCTAAATTGCTCGG + Intergenic
985198654 4:187461221-187461243 GAATACTTTTGCTAAGTGCTGGG + Intergenic
988214924 5:28259555-28259577 AAATATTATTTTTGAGTGCTGGG + Intergenic
993007800 5:82447022-82447044 TAATAGTCTTCTAAACTGCTAGG - Intergenic
993399728 5:87433874-87433896 GATTAGTATCCTTATGTGGTTGG + Intergenic
993432597 5:87850164-87850186 TAAGAATATTTTTAAGTGCTTGG - Intergenic
993808635 5:92444505-92444527 CAATAGTATATTTTAGTGCTGGG + Intergenic
994320438 5:98388278-98388300 GAAAAATCTTTTTAAGTGCTTGG + Intergenic
996551463 5:124734964-124734986 GAAAAGTCTTATTAAGTGATGGG + Intronic
997114755 5:131113956-131113978 GATTAGTATTGCTTAGTGCTAGG + Intergenic
997166593 5:131666686-131666708 AAATAGTACACTTAAGTGCCTGG + Intronic
998702637 5:144721214-144721236 AAATTGTATTATTAAGTGCCAGG + Intergenic
1001145865 5:169183987-169184009 GAAGAGTTTTCTAAAGTGATCGG - Intronic
1002068804 5:176666162-176666184 GAATAGGTTTCTTATTTGCTGGG - Intergenic
1002166274 5:177349161-177349183 GACTAGAACTCTTAAGTGCCTGG - Intronic
1004933744 6:20487487-20487509 GAATAGTATTCTTAAGTGCTAGG - Intronic
1009924606 6:70104529-70104551 AAATTGTAGTCTTCAGTGCTGGG - Intronic
1009937854 6:70254776-70254798 GAATAGTATAATTATTTGCTTGG - Intronic
1011553824 6:88554291-88554313 TCATACTATTCTTAACTGCTGGG + Intergenic
1014404842 6:121038201-121038223 GAATAAAATTCTTTAGTGCATGG + Intergenic
1016919952 6:149282909-149282931 AAACAGCATTCTTAACTGCTGGG + Intronic
1017577861 6:155825689-155825711 AAATTGTCTTCTTAAGTGATTGG - Intergenic
1023961580 7:44931590-44931612 TAATAGTATTCTAAAATCCTTGG - Intergenic
1031500848 7:122514024-122514046 GAATAATATTCTCAAATGATTGG - Intronic
1037212797 8:16412621-16412643 GGACAGTATGCTTAAGTGCATGG - Intronic
1038343645 8:26711605-26711627 GAATAGAATTGTTAAGTTATAGG + Intergenic
1038912755 8:31985253-31985275 AACTAGAATTCTTAAGTGCTTGG - Intronic
1040592999 8:48812855-48812877 GAATAGTATTATTAGGTGAGGGG + Intergenic
1040603635 8:48909037-48909059 GAATAATTTTCTTGAGTTCTAGG - Intergenic
1041982666 8:63881162-63881184 GAATAGAATTATTAAGTGAGGGG - Intergenic
1042829852 8:73015022-73015044 GAAAAGTATTCTAAAGTGCCTGG + Intronic
1044197303 8:89392892-89392914 TAATAGTATTCATAATTTCTGGG - Intergenic
1050138274 9:2491108-2491130 TAAAAGTATTCTTAAATGGTGGG - Intergenic
1051909941 9:22141850-22141872 GAATAATAAACTTAAGTCCTAGG + Intergenic
1052535957 9:29747878-29747900 AAATAATATTTTTAAGTTCTGGG + Intergenic
1052587586 9:30449139-30449161 GAATAGTATTGATAAGATCTGGG - Intergenic
1058685750 9:107478242-107478264 GAGGTGTATTCTTAAGAGCTGGG + Intergenic
1060259775 9:122063942-122063964 GAAAGGTATTCCTAAGTGTTAGG + Intronic
1060702437 9:125768770-125768792 GGACAGTTTTTTTAAGTGCTGGG + Intronic
1189480867 X:41391426-41391448 AAAGAGTATGTTTAAGTGCTGGG - Intergenic
1190790233 X:53692937-53692959 AAATAGTATTGTTCATTGCTAGG - Intergenic
1195165846 X:102219544-102219566 GAATAATATTATTTAGGGCTTGG + Intronic
1195193012 X:102467547-102467569 GAATAATATTATTTAGGGCTTGG - Intronic
1195617352 X:106922740-106922762 GAATAGCATGCTTACGGGCTTGG + Intronic
1197203897 X:123773190-123773212 AAATAGTATCCTCAAGTTCTGGG - Intergenic
1197354313 X:125418011-125418033 CAATAATCTTCTTAAGTACTGGG - Intergenic
1197894480 X:131296829-131296851 GAAAAATAGTCTTTAGTGCTTGG + Intronic