ID: 1004935168

View in Genome Browser
Species Human (GRCh38)
Location 6:20500306-20500328
Sequence GTGAAAACATAGATGAACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004935164_1004935168 12 Left 1004935164 6:20500271-20500293 CCTTAAAAAAGATTTTTTTTAAA No data
Right 1004935168 6:20500306-20500328 GTGAAAACATAGATGAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004935168 Original CRISPR GTGAAAACATAGATGAACCT TGG Intergenic
No off target data available for this crispr