ID: 1004942972

View in Genome Browser
Species Human (GRCh38)
Location 6:20580638-20580660
Sequence CCCTCTCCAGGTTATAAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004942968_1004942972 1 Left 1004942968 6:20580614-20580636 CCTTTATTTTTAATTACCAAACT 0: 1
1: 0
2: 1
3: 45
4: 669
Right 1004942972 6:20580638-20580660 CCCTCTCCAGGTTATAAGTAAGG 0: 1
1: 0
2: 1
3: 12
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004942972 Original CRISPR CCCTCTCCAGGTTATAAGTA AGG Intronic
902888764 1:19426217-19426239 TCCTGTCCAGTTTATAGGTAAGG + Intronic
904125766 1:28237055-28237077 CCCTCTCCTGCTTAGGAGTATGG + Intronic
907695414 1:56721988-56722010 CCCACTACAGGTAATAAGAATGG + Intronic
908242217 1:62196953-62196975 CCCACACTAGATTATAAGTAGGG - Intronic
911533781 1:99077208-99077230 CCCTGTCCAGGATATACGGAAGG - Intergenic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
914862955 1:151401340-151401362 CCCTCACCCGGTTGTAAGAACGG - Exonic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
922139226 1:222865427-222865449 CCCACTCCCTCTTATAAGTATGG - Intergenic
922974456 1:229772148-229772170 CCCGCTCCAGGCTCTAAGTGGGG - Intergenic
1063242191 10:4182558-4182580 CCATCTCCAGGGTATCAGTCAGG + Intergenic
1071083214 10:81837710-81837732 CATTCTCCAGGTTTTAAGTGGGG - Intergenic
1075732903 10:124646898-124646920 ACCTCTCCAGGTTCTAAGTGAGG + Intronic
1081093394 11:38900815-38900837 CCCCCACCAGGTTAGAATTAGGG + Intergenic
1082689680 11:56284851-56284873 CACTCTGCAGGTTATATTTAAGG + Intergenic
1083568115 11:63737674-63737696 CCCTCTCCAGGTGAATAGTATGG - Intronic
1084472763 11:69372905-69372927 CTTTCTCCAGGTCATAAGTGAGG - Intergenic
1086508001 11:87526142-87526164 CCCTCTCAAGGTTATCTGTGAGG + Intergenic
1090137051 11:124209777-124209799 CCCTCTCCAGCTTGGAGGTAGGG + Intergenic
1091314942 11:134607984-134608006 CCCTCTCCAGATCTTAAGCAAGG - Intergenic
1094068392 12:26385532-26385554 ACCTCTAAAGGTTATAACTAAGG - Intronic
1097158393 12:57028869-57028891 CCCTCTCCAGGTTCTCAGTGAGG - Exonic
1100592250 12:96040303-96040325 TCCTCTCCAGGTTATACATCTGG + Intronic
1101700218 12:107166911-107166933 CCATCTGTAGGTTTTAAGTAAGG - Intergenic
1109795129 13:67301171-67301193 CCTACTCCAGGAAATAAGTAGGG - Intergenic
1113875942 13:113594475-113594497 CCCTGTCCAGGTGACAGGTATGG + Intronic
1115323662 14:32113383-32113405 CCCTCCCCTTGTTATATGTATGG + Intronic
1116308723 14:43293225-43293247 CCCACTCCTGGTTCTAAGTGTGG - Intergenic
1121003466 14:90470011-90470033 TCCTCCCCAGGTTACAAGTTTGG - Intergenic
1121024548 14:90605508-90605530 TCCTCTCCAGCTTATCAGTTAGG + Intronic
1126325915 15:47477253-47477275 CTCTATCCAGGTTATTAGGACGG - Intronic
1129935987 15:79450798-79450820 CCCTCTGCAGGTTATAAAAAAGG - Intronic
1131508657 15:93036809-93036831 CCCACTCCAGGTTACAAGCAGGG - Intronic
1135059726 16:19260929-19260951 CCCTCTCCATGTTATAGGTAAGG - Intronic
1139700963 16:68707760-68707782 CCCTCTCCAAGTTAGAGGTGGGG + Intronic
1139842080 16:69889729-69889751 GCCTCTCCTGGTTATCAGTTTGG + Intronic
1142685481 17:1574989-1575011 CCCTCTCCAGGGCATAAGCCAGG + Exonic
1142780596 17:2178547-2178569 ACCTCTCCATGTTCTAAGCAGGG + Intronic
1146646757 17:34581376-34581398 TCCTCTCCTGGTTATAAAGAAGG + Intronic
1148109866 17:45138212-45138234 CCCTCTGCAGGTCCTGAGTAAGG + Intronic
1148482999 17:47972199-47972221 CCATCTCCAGGTTGTCTGTATGG + Intronic
1151842114 17:76626182-76626204 CCATCTCCAGGTGATAGCTAAGG + Intronic
1155999448 18:32368568-32368590 CCATCTAGAGGTTATAAATAAGG - Intronic
1157346309 18:46838328-46838350 CCATCCCCATGTTATAAATAAGG + Intronic
1158440639 18:57471394-57471416 CTCTCTCCAGGTTAGAGGTGGGG + Intronic
1168277933 19:55287336-55287358 CCCTCTCCAGGTTACCAGGGTGG + Intronic
926259401 2:11243441-11243463 CCTTCTCCAAGTGATAAATATGG + Intronic
927889352 2:26738713-26738735 CCCTCTCCGGGGTCTAAGTAGGG + Intergenic
939425610 2:142032435-142032457 CTCTCTCCAGCTTCTAAATATGG - Intronic
945128257 2:206537407-206537429 CCCTGTCCAGTGTATGAGTAAGG + Intronic
1174319413 20:49729177-49729199 CCCTCTCCAACATGTAAGTAGGG + Intergenic
1175126639 20:56757169-56757191 CCCTCTTCGGGTTTTAAGAATGG - Intergenic
1176408888 21:6437111-6437133 CCCTCTGCAGGTGCTATGTAGGG + Intergenic
1179684381 21:43045433-43045455 CCCTCTGCAGGTGCTATGTAGGG + Intergenic
1183163467 22:36130427-36130449 CCCTCTCCAGGAAGTAAGGAGGG - Intergenic
953339788 3:42123729-42123751 CCCTCTCCAAGATATTAGAAGGG - Intronic
954489679 3:50891500-50891522 CCATCTCAAGTTTATAAGTAAGG + Intronic
954942575 3:54388159-54388181 CTCTCTTCAGGTCATAAGTATGG - Intronic
959156344 3:102670969-102670991 CACTCTTCAGCTTATAAGCAGGG - Intergenic
959403015 3:105925577-105925599 CCATCTCTAGGTTGTAAATATGG + Intergenic
959904979 3:111701448-111701470 CAGTTTCCAGGCTATAAGTAGGG + Intronic
960316233 3:116180706-116180728 ACATCTCTAGTTTATAAGTAGGG + Intronic
964520481 3:157561583-157561605 CTCTCTCCAGGCAATAAGTTAGG + Intronic
965603041 3:170473429-170473451 ACCTCTCTCGGTTCTAAGTATGG - Intronic
967520873 3:190431515-190431537 CCCTTTGCAGTTTATAAGTTTGG + Intronic
967733310 3:192926353-192926375 CTCTCTCCAGGTTATACATTTGG - Intergenic
976831609 4:89321336-89321358 CCCTCTCCAGATTTTAACCATGG + Intergenic
977387744 4:96364736-96364758 CCCTCTCCATGTCTTAAGTCAGG + Intergenic
980626794 4:135382814-135382836 CTCTCTCCAGGCAATGAGTAAGG + Intergenic
981362336 4:143862008-143862030 CCCTCTCCAGGGAATTATTAGGG + Intergenic
981382164 4:144086050-144086072 CCCTCTCCAGGGAATTATTAGGG + Intergenic
988934617 5:36069683-36069705 CCCGCTCCAAGTTATATGAAGGG - Intronic
990813529 5:59755881-59755903 TCCTCTTCATGTTATTAGTAGGG - Intronic
991603862 5:68380714-68380736 TCATTTCCAGGTTATAATTAAGG + Intergenic
1003786340 6:9491055-9491077 CCTTCTCCTGGTGATAAGTGGGG - Intergenic
1004880373 6:20001679-20001701 TCCTCCCCATGTTATAGGTAAGG + Intergenic
1004942972 6:20580638-20580660 CCCTCTCCAGGTTATAAGTAAGG + Intronic
1007654314 6:43443092-43443114 CCCTCTCCAGGTACTCAGTGCGG - Exonic
1008843421 6:55933059-55933081 CCTCCTCCAGATTATAATTATGG + Intergenic
1012662502 6:101920144-101920166 CCCTCTTCATTTTATAAATATGG + Intronic
1014888250 6:126808842-126808864 CCCCCTCCAGGACATAAGAAAGG + Intergenic
1020471450 7:8540460-8540482 CCCTCTCAAGGCAATAAGTAAGG - Intronic
1021105473 7:16634364-16634386 CCCTCTTAAGGTTATAAGCTAGG - Intronic
1023375305 7:39549852-39549874 CCCTCTCCATTTTATAGATAAGG - Intergenic
1025820218 7:64955701-64955723 CCCTGTCCTGGTGATAAGGAAGG + Intergenic
1029300358 7:99578169-99578191 CACTTTCCAGGTAATAAGTGAGG + Intronic
1029414039 7:100431830-100431852 ACCTTTCCAGGTTATAAGAGGGG - Intronic
1031391189 7:121216988-121217010 CCACCTCCAGATAATAAGTAAGG - Intronic
1041725033 8:61010313-61010335 CCCAGTCCAGGTCATGAGTAAGG + Intergenic
1045307880 8:100974527-100974549 TCCTCTCCAGGTGAAAAGTCAGG + Intergenic
1045734379 8:105277784-105277806 TGCTTTCCAGGTTCTAAGTAAGG + Intronic
1048240023 8:132732109-132732131 CCCTCTCCAGATCATGAGTAAGG - Intronic
1050703934 9:8373763-8373785 CCCTCTGTAGATTATAAGCAAGG - Intronic
1053168913 9:35864533-35864555 CCGTCTCCATGGTATAGGTAAGG - Intergenic
1058779956 9:108323460-108323482 TCTTCTCCAGGTTATAAATAAGG + Intergenic
1187481707 X:19662087-19662109 CCTTCTCCAAGTTATTAGTAAGG + Intronic
1188542176 X:31263108-31263130 CCATCTCCAGGATATTTGTAAGG + Intronic
1199575783 X:149312463-149312485 CACTTTCCAGGTGATAAGAATGG + Intergenic
1202340288 Y:23857175-23857197 CCTTCACCAGGTTCTGAGTATGG + Intergenic
1202530478 Y:25812907-25812929 CCTTCACCAGGTTCTGAGTATGG - Intergenic