ID: 1004947263

View in Genome Browser
Species Human (GRCh38)
Location 6:20629723-20629745
Sequence AGAGCTGCGGCACAATGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 223}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004947263_1004947275 28 Left 1004947263 6:20629723-20629745 CCATCCCATTGTGCCGCAGCTCT 0: 1
1: 0
2: 3
3: 11
4: 223
Right 1004947275 6:20629774-20629796 AGATGCCCCATGTTCTTCTTGGG No data
1004947263_1004947274 27 Left 1004947263 6:20629723-20629745 CCATCCCATTGTGCCGCAGCTCT 0: 1
1: 0
2: 3
3: 11
4: 223
Right 1004947274 6:20629773-20629795 GAGATGCCCCATGTTCTTCTTGG No data
1004947263_1004947267 -8 Left 1004947263 6:20629723-20629745 CCATCCCATTGTGCCGCAGCTCT 0: 1
1: 0
2: 3
3: 11
4: 223
Right 1004947267 6:20629738-20629760 GCAGCTCTGTCACCCTGTGCTGG 0: 1
1: 0
2: 3
3: 37
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004947263 Original CRISPR AGAGCTGCGGCACAATGGGA TGG (reversed) Intronic
902105513 1:14032666-14032688 AGAGCTGAGCCAGGATGGGAGGG - Intergenic
903030757 1:20462691-20462713 ATGGCTGCTGCACAATGGGGAGG + Intergenic
904049729 1:27631958-27631980 AGAGATGCGGCACAGTGGGATGG - Intronic
907602284 1:55783646-55783668 AGAGCTCCCATACAATGGGAGGG + Intergenic
908717653 1:67087416-67087438 AGAGCTCCCATACAATGGGAGGG - Intergenic
912463410 1:109852697-109852719 AGAGCTCCCACACAATGGAAGGG + Intergenic
912464102 1:109857844-109857866 AGAGCTCCCATACAATGGGAGGG + Intergenic
912575508 1:110667932-110667954 AGAGCTGAGTCACAATAGTAAGG + Intergenic
913971344 1:143420472-143420494 AGGGCTGGGGGACCATGGGATGG + Intergenic
914065721 1:144246085-144246107 AGGGCTGGGGGACCATGGGATGG + Intergenic
914113430 1:144720269-144720291 AGGGCTGGGGGACCATGGGATGG - Intergenic
916647005 1:166796657-166796679 AAAGCTGCTGCAGAATGGGGTGG + Intergenic
917179748 1:172283288-172283310 AGAGGTGGGGCACAGTGGGAAGG - Intronic
917413357 1:174782967-174782989 AGAGCTCCCATACAATGGGAGGG - Intronic
917595657 1:176526668-176526690 AGAGGTGTGGAACAAGGGGAGGG - Intronic
917724012 1:177812662-177812684 AGAGCTCCCATACAATGGGAGGG - Intergenic
917759498 1:178141248-178141270 AGAGCTCCCATACAATGGGAGGG + Intronic
920639862 1:207741627-207741649 AGAGCTCCCACACAAAGGGAGGG + Intergenic
922153034 1:223021291-223021313 AGAGCTGGGGGCCAATGGGCCGG + Intergenic
1066387541 10:34953899-34953921 AGAGAGGCGGCACACTGGGTTGG + Intergenic
1068988857 10:63131116-63131138 AGAGCTCCCATACAATGGGAGGG + Intergenic
1070623121 10:78029260-78029282 AGAGATGGGGTGCAATGGGAAGG - Intronic
1071082712 10:81831413-81831435 AGAGCTCCCATACAATGGGAGGG + Intergenic
1074978473 10:118599990-118600012 AGAGCTCCCATACAATGGGAGGG + Intergenic
1076424287 10:130356493-130356515 AGAGCTCCCATACAATGGGAGGG - Intergenic
1077310408 11:1886445-1886467 AGGGCTGGGGGACCATGGGATGG - Intronic
1079117007 11:17646284-17646306 AGAGCTGTGGGAAGATGGGAAGG + Intronic
1079857734 11:25627797-25627819 AGAGCTCCCATACAATGGGAAGG - Intergenic
1079933265 11:26590907-26590929 AGAGCTCCCATACAATGGGAGGG + Intronic
1080400355 11:31929043-31929065 AGTGTTGGTGCACAATGGGAAGG + Intronic
1081070171 11:38601871-38601893 AGAGCTCCCATACAATGGGAGGG - Intergenic
1081070851 11:38606744-38606766 AGAGCTCCCATACAATGGGAGGG - Intergenic
1081614964 11:44585396-44585418 AAAGCTGAGGCACAGTGGTAAGG + Intronic
1082737593 11:56873800-56873822 AGAGCTCCCATACAATGGGAGGG - Intergenic
1083340748 11:61957018-61957040 AGGGCTGCCGCAGAGTGGGAAGG + Intronic
1084667022 11:70582014-70582036 GGAGCTGCTGGTCAATGGGAGGG + Intronic
1085379086 11:76096513-76096535 AGAGCTGCCCAACAATGGAATGG + Intronic
1085773271 11:79343118-79343140 ATAGCTTGGGCACAAGGGGATGG + Intronic
1086511216 11:87560022-87560044 AGAGCTCCCATACAATGGGAGGG + Intergenic
1088242915 11:107789542-107789564 AGAGCTCCCATACAATGGGAGGG - Intergenic
1089535166 11:119156545-119156567 AGAGCTGCAGCAGAAAGAGAAGG - Exonic
1090318930 11:125823929-125823951 TGCGCTGGGGCACAAGGGGAGGG + Intergenic
1091449699 12:564887-564909 AGAGCTGCTAGACAATGGCAGGG + Intronic
1092293633 12:7181165-7181187 AGAGCTCCTGTACAACGGGAGGG - Intergenic
1092469932 12:8768428-8768450 AGAGCTCCTGTACAAAGGGAGGG + Intronic
1095139259 12:38641499-38641521 AGAGCTCCCATACAATGGGAGGG - Intergenic
1095283456 12:40383906-40383928 AGAGCTCCCATACAATGGGAGGG - Intergenic
1098113538 12:67150086-67150108 AGAGCTGTGGCATAATGATATGG + Intergenic
1098220967 12:68269524-68269546 AGAACTGCTGCACAATGGAATGG + Intergenic
1100205076 12:92339808-92339830 AGAGCTCCCATACAATGGGAGGG + Intergenic
1101592006 12:106133141-106133163 TGTGCTGGGACACAATGGGAGGG - Intronic
1102225800 12:111227566-111227588 AGGACTGCAGCCCAATGGGAAGG - Intronic
1103803918 12:123557683-123557705 AGAGCTCCCATACAATGGGAGGG - Intergenic
1105991887 13:25630463-25630485 AGGGCTGGGGCACACTGGCAGGG - Intronic
1107137404 13:36958929-36958951 AGAGCTCCCATACAATGGGAGGG - Intronic
1108245945 13:48514283-48514305 AGAGATGCTGGACAAAGGGATGG + Intronic
1108947985 13:56046442-56046464 AGAGCTCCCTTACAATGGGAAGG + Intergenic
1109380910 13:61558415-61558437 AGAGCTCCCACACAATGGGAGGG + Intergenic
1110362160 13:74639394-74639416 AGAGTGGCGGCAGAATGAGAGGG - Intergenic
1111910283 13:94303177-94303199 AGAGCTGCCATACAATGGGAGGG + Intronic
1113342576 13:109441271-109441293 GGAGCTGAGGCACACTGGGCAGG + Intergenic
1113592286 13:111509471-111509493 AGAGCTCCCGTACAACGGGAAGG + Intergenic
1113642161 13:111965423-111965445 AGAGGTGGGGAACAAGGGGAGGG - Intergenic
1115151655 14:30293162-30293184 AGAGCTCCCATACAATGGGAGGG - Intergenic
1116857615 14:49966782-49966804 AGGACTGCACCACAATGGGAAGG - Intergenic
1117747558 14:58886248-58886270 AGAGCTGAGGCAGTATGAGAGGG - Intergenic
1119140299 14:72261294-72261316 AGAGCTACGGCACAGAGTGATGG + Intronic
1120341425 14:83225593-83225615 AGAGCTCCCATACAATGGGAGGG - Intergenic
1121064214 14:90946272-90946294 AGGGCTGCAGCACAATGGAGAGG - Intronic
1121803563 14:96795612-96795634 AGACCTGAGGCACAAAGGGAAGG + Intergenic
1127282252 15:57502320-57502342 AGAGCTGTGGGAAAATGGAAAGG + Intronic
1128081946 15:64862080-64862102 TGAGCTGAGGCACAGCGGGAGGG + Intronic
1128649265 15:69398568-69398590 AGGGCTGAGGGACAAGGGGAGGG + Intronic
1131673837 15:94651027-94651049 AGAGCTGCCATACAAAGGGAGGG - Intergenic
1133200150 16:4199241-4199263 AGGGCTGAGGCAGACTGGGATGG - Intronic
1135552318 16:23408049-23408071 AAAGCTGTGGCACAGTGGGAAGG + Intronic
1136536627 16:30903362-30903384 AGGGCTGAGGCCCAAAGGGATGG - Exonic
1136867754 16:33770429-33770451 AAAGCTGCGGCAAAAAGGGGCGG - Intergenic
1141298446 16:82791494-82791516 AGAGCTCCCATACAATGGGAGGG - Intronic
1203104406 16_KI270728v1_random:1345774-1345796 AAAGCTGCGGCAAAAAGGGGCGG + Intergenic
1203129108 16_KI270728v1_random:1616594-1616616 AAAGCTGCGGCAAAAAGGGGCGG - Intergenic
1143640455 17:8193549-8193571 ACAGTTGCGACATAATGGGAAGG + Intergenic
1143645006 17:8224246-8224268 AAAGCTGGGGCCCAAGGGGAGGG - Intergenic
1148229148 17:45920427-45920449 TGAGCTGAGGGACCATGGGAAGG - Intronic
1149478405 17:56982552-56982574 AAAGGTGCGGCACAATTGGCAGG + Intronic
1155838210 18:30613607-30613629 AGAGCTGCAGCAGCATGTGAAGG + Intergenic
1166023454 19:40055283-40055305 TGGGAGGCGGCACAATGGGAGGG + Intronic
927178874 2:20429664-20429686 ACAGCTGCGGCACAGAGGCAAGG - Intergenic
928240474 2:29581438-29581460 AGAGCAGCTGCTCAAAGGGAGGG + Intronic
929753718 2:44745139-44745161 AGAGCAGCGGCAAAAGGGAAGGG + Intronic
930631143 2:53756657-53756679 AGAGCTCCCATACAATGGGAGGG - Intronic
931861022 2:66354608-66354630 AGAGCTGCAGCACAAGGAGGTGG - Intergenic
934176039 2:89581405-89581427 AGGGCTGGGGGACCATGGGATGG + Intergenic
934286349 2:91655767-91655789 AGGGCTGGGGGACCATGGGATGG + Intergenic
936983925 2:118290268-118290290 AGAGATGGGGGACAATGGAAGGG - Intergenic
937464439 2:122119078-122119100 AGAGGTGGGGGACTATGGGAGGG - Intergenic
937672103 2:124548969-124548991 TCAGCTGGGGCACAAGGGGATGG + Intronic
937887765 2:126911680-126911702 AGAGCTGGGGCCCTATGGAAAGG - Intergenic
938308305 2:130268969-130268991 AGAGCTGGGGCTCAGTGGGCAGG - Intergenic
938447024 2:131387867-131387889 AGAGCTGGGGCTCAGTGGGCAGG + Intergenic
938925320 2:136034977-136034999 AGAGAAGCAGCCCAATGGGAGGG + Intergenic
939494115 2:142907602-142907624 AGAGCTCCCATACAATGGGAGGG + Intronic
940669031 2:156645031-156645053 AGAGCTCCTACACAAAGGGAGGG - Intergenic
943462378 2:188184789-188184811 AGAGCTCCCATACAATGGGAGGG + Intergenic
946050981 2:216862383-216862405 AGATGTGGGGCAAAATGGGAAGG - Intergenic
947325025 2:228964615-228964637 ACAGCTGCTGCACAAGGAGAAGG - Intronic
948076450 2:235168584-235168606 AGAGCTGAGGCATAATGTGCAGG + Intergenic
948517634 2:238514096-238514118 AGAGCTCCCATACAATGGGAGGG - Intergenic
1172949025 20:38710488-38710510 AGAGCCCCAGCACAATGGGCTGG + Intergenic
1173276238 20:41586139-41586161 AGAGCTCCCATACAATGGGAGGG - Intronic
1173387176 20:42599489-42599511 AGAGATGGGGTGCAATGGGAGGG + Intronic
1177359373 21:20048757-20048779 AGAGCTCCCATACAATGGGAGGG + Intergenic
1177738111 21:25118674-25118696 AGAGCTCCCATACAATGGGAGGG - Intergenic
1180117376 21:45719212-45719234 AGAGCTGAGGCAGTTTGGGAAGG + Intronic
1180214309 21:46314896-46314918 AGAGCTGCTGCACACGGGGACGG + Intronic
1182093843 22:27613378-27613400 AGAGCTGCTGCCCACTGGGGAGG - Intergenic
1183316992 22:37142322-37142344 AGAGCTGAGGCCCAATGGCTGGG - Intronic
1184670977 22:46012230-46012252 AGAGCTGAGGGACACTGGGCTGG + Intergenic
949811682 3:8013083-8013105 AGAGCTGCCATACAAAGGGAGGG + Intergenic
950544804 3:13631966-13631988 GGAGGGGCTGCACAATGGGAGGG + Intronic
952888110 3:38024292-38024314 AGATCTGCGGGGGAATGGGAAGG - Intronic
954129793 3:48554602-48554624 GAAGCTGAGGCCCAATGGGAAGG - Intronic
955511149 3:59681535-59681557 AGAGATGTGGCAGATTGGGATGG + Intergenic
956651761 3:71510558-71510580 ACAGGTGCAGCACAATGGAAAGG + Intronic
957557714 3:81782196-81782218 AGAGCTCCCATACAATGGGAGGG - Intergenic
957687032 3:83515183-83515205 AGAGCTCCCACACAAAGGGAGGG - Intergenic
957807864 3:85174108-85174130 AGAGCTGCCCAACAATGAGATGG - Intronic
958457059 3:94345416-94345438 AGAGCTCCCATACAATGGGAGGG + Intergenic
959406332 3:105966060-105966082 AGAGCTCCTATACAATGGGAGGG - Intergenic
960141176 3:114152991-114153013 AGAGCTCAGACACAAGGGGAGGG - Intronic
960158994 3:114329168-114329190 AGAGGTACAGCAGAATGGGATGG + Intergenic
961104013 3:124225626-124225648 AGAGGTGGGGCACAATGAGTGGG + Intronic
963024079 3:140901043-140901065 AGAGCTCCCGTACAATGGGAGGG - Intergenic
966511233 3:180765777-180765799 AGAGCTCCCATACAATGGGAGGG + Intronic
968181451 3:196598549-196598571 AGAGCTTCCACACAATGGAAGGG + Intergenic
968546835 4:1203240-1203262 ACAGCTGGGGGAAAATGGGAAGG - Intronic
968921866 4:3526542-3526564 CGGGCTGCGGGACACTGGGAAGG - Intronic
969227124 4:5806031-5806053 AGGGCGGCGGGACGATGGGAGGG - Intronic
971076762 4:23158273-23158295 AGAGCTTCCATACAATGGGAGGG - Intergenic
971439447 4:26664674-26664696 AGAGCTCCCACACAATGGGAGGG + Intronic
972780845 4:42285853-42285875 AGAGCTCCCATACAATGGGAGGG + Intergenic
973245887 4:48010959-48010981 AGAGCTCCCGTACAAAGGGAGGG + Intronic
974190494 4:58496656-58496678 AGAGCTTCCATACAATGGGAGGG + Intergenic
975418832 4:74138779-74138801 AGAGCTCCCATACAATGGGAGGG + Intronic
977617712 4:99104769-99104791 AGAGCTCCCATACAATGGGAGGG + Intergenic
977618445 4:99109918-99109940 AGAGCTCCCATACAATGGGAGGG + Intergenic
978777691 4:112519368-112519390 AGGGCTGGGGGACAAGGGGAGGG + Intergenic
980860000 4:138487479-138487501 ACAGCTGGGGCCAAATGGGAAGG - Intergenic
980871979 4:138622241-138622263 AGAGCTCCTGTACAAAGGGAGGG + Intergenic
984280681 4:177666742-177666764 AGAGCTCCCACACAAGGGGAGGG + Intergenic
984771111 4:183436774-183436796 AGTGCTGAGGCACAAAGGCAGGG - Intergenic
987738463 5:21874586-21874608 AGAGCTCCCATACAATGGGAGGG - Intronic
987905340 5:24069265-24069287 AGAGCTCCCATACAATGGGAGGG - Intronic
988735998 5:34021969-34021991 ACAGCTGTGGCACAATCTGATGG + Intronic
988740550 5:34064773-34064795 AGAGCTCCCATACAATGGGAGGG + Intronic
988881468 5:35508026-35508048 AGAGCTCCCATACAATGGGAAGG - Intergenic
988956805 5:36328729-36328751 AGAGCTCCCACACAAAGGGAGGG + Intergenic
989688419 5:44114561-44114583 AGAGCTCCCATACAATGGGAGGG - Intergenic
990564458 5:57015334-57015356 AGAGCTCCCATACAATGGGAGGG + Intergenic
990891799 5:60658769-60658791 AGAGCTCCCATACAATGGGAGGG - Intronic
990892798 5:60665975-60665997 AGAGCTCCCATACAATGGGAGGG - Intronic
990905168 5:60795513-60795535 AGAGCTCCCATACAATGGGAGGG - Intronic
993622836 5:90188374-90188396 AGAGCTCCCATACAATGGGAGGG + Intergenic
995742758 5:115372121-115372143 AGAGCAACAGTACAATGGGATGG + Intergenic
997333651 5:133087199-133087221 AGAGCTACAGCAAAGTGGGAAGG + Intronic
997708062 5:135977563-135977585 AGAGCGGCGGTGCAACGGGACGG - Intergenic
997779327 5:136641009-136641031 GGGGCAGCGGCACAATGGGATGG - Intergenic
998567303 5:143226908-143226930 ATACCTGCGGCTCAAAGGGAAGG + Intronic
998644302 5:144045420-144045442 AGAGCTCCCATACAATGGGAGGG - Intergenic
999246603 5:150158284-150158306 AGAGATGCAGCACAAAGGGGAGG + Intergenic
1000457561 5:161470621-161470643 GGAGCTGCTGGACAAAGGGATGG + Intronic
1001910553 5:175513928-175513950 GCAGCTGGGGCACAGTGGGAGGG + Intronic
1004236354 6:13878354-13878376 AGAGCTCCCATACAATGGGAGGG - Intergenic
1004237107 6:13883672-13883694 AGAGCTCCCATACAATGGGAGGG - Intergenic
1004947263 6:20629723-20629745 AGAGCTGCGGCACAATGGGATGG - Intronic
1009519559 6:64664175-64664197 AGAGCTCCCATACAATGGGAGGG + Intronic
1010852838 6:80799422-80799444 GGGGTTGGGGCACAATGGGAGGG - Intergenic
1013512555 6:110858208-110858230 CGCGCTGCGGCAGGATGGGATGG - Intronic
1016342578 6:143079831-143079853 AGAGCTCCTATACAATGGGAGGG + Intronic
1016343658 6:143087669-143087691 AGAGCTCCCATACAATGGGAGGG + Intronic
1018884346 6:167920431-167920453 TGAGATGCAGCACACTGGGAAGG - Intronic
1019211015 6:170404910-170404932 AGCTCTTCTGCACAATGGGAGGG - Exonic
1019265874 7:117370-117392 AAACCTGCGCCACAATGGGTGGG + Intergenic
1021126208 7:16853245-16853267 AGAGCTCCCATACAATGGGAGGG - Intergenic
1023094781 7:36649656-36649678 AGAGCTCCCAAACAATGGGAGGG - Intronic
1023282941 7:38590486-38590508 AGAGCTCCCATACAATGGGAGGG + Intronic
1023439781 7:40173469-40173491 AGAGCTCCCATACAATGGGAGGG + Intronic
1023941498 7:44771345-44771367 GAAGCTGGGGCAGAATGGGAGGG - Intergenic
1024318661 7:48044333-48044355 AGAGCTCCCATACAATGGGAGGG + Intronic
1026346960 7:69482704-69482726 AGAGCTCCCATACAATGGGAGGG - Intergenic
1028013977 7:85684007-85684029 AGAGCTCCCACACAAAGGGAGGG - Intergenic
1028926161 7:96358824-96358846 AGAGCTCCCATACAATGGGAGGG + Intergenic
1031250887 7:119379057-119379079 AGAGCTCCCATACAATGGGAGGG + Intergenic
1031471989 7:122177088-122177110 AGAGCTCCCATACAATGGGAGGG - Intergenic
1032061658 7:128730090-128730112 AGGGCTGCCCCACAATGGCAGGG - Intronic
1032425805 7:131821305-131821327 AGAGCTCCCATACAATGGGAGGG + Intergenic
1032725332 7:134585699-134585721 AGAGCTCCCATACAATGGGAGGG - Intergenic
1032726284 7:134592529-134592551 AGAGCTCCCATACAATGGGAGGG - Intergenic
1034707088 7:153155311-153155333 AGAGCTCCCATACAATGGGAGGG + Intergenic
1035195082 7:157211767-157211789 AGAGCTGTGTCACTATGGGTGGG - Intronic
1035681628 8:1492830-1492852 AGAGCTGCGGGACAGTAGGCCGG + Intergenic
1036679620 8:10861689-10861711 AGAGCTGCAGAAAAATGGGCTGG - Intergenic
1037379968 8:18274762-18274784 AGAGCTCCCATACAATGGGATGG + Intergenic
1037390613 8:18387641-18387663 AGAGCTGCGGCAAAAAGGGAAGG - Intergenic
1041663228 8:60419444-60419466 AGAGCTCCCATACAATGGGAGGG + Intergenic
1041664100 8:60425479-60425501 AGAGCTTCCATACAATGGGAGGG + Intergenic
1045863526 8:106839497-106839519 AGAGCTCCCATACAATGGGAGGG + Intergenic
1047904648 8:129460033-129460055 AAAGCTTCAGGACAATGGGACGG + Intergenic
1048775898 8:137945770-137945792 ATAGCTACGAAACAATGGGAGGG - Intergenic
1049392468 8:142379332-142379354 AGAGCTGCTGCTCACTGGGAGGG - Intronic
1052286018 9:26786607-26786629 GGAGGTGGGGCTCAATGGGAGGG + Intergenic
1052866568 9:33467792-33467814 AGAGCTGCAGGACAATGGTGGGG - Exonic
1055369529 9:75582377-75582399 GGAGGTGCGGCCTAATGGGAGGG + Intergenic
1055789855 9:79912075-79912097 AGAGCTCCCATACAATGGGAGGG + Intergenic
1060791298 9:126487367-126487389 AGAGCAGCGGGACAGTGGAATGG - Intronic
1061876086 9:133544777-133544799 AGAGCTGCTGGACAATGGGAGGG + Intronic
1185431228 X:13296-13318 ACAGGTGGGGCAGAATGGGAGGG - Intergenic
1185440495 X:225693-225715 ACAGGTGGGGCAGAATGGGAGGG - Intergenic
1185656717 X:1691369-1691391 ACAGCTCGGGCACAAAGGGAGGG - Intergenic
1185700366 X:2226952-2226974 AGAGCTGCTGCAGAATAAGAAGG + Intronic
1186254543 X:7704028-7704050 AGAGCTCCCACACAAAGGGAGGG + Intergenic
1188157337 X:26756092-26756114 AGAGCTCCCATACAATGGGAGGG + Intergenic
1188285573 X:28322384-28322406 AGAGCTCCCATACAATGGGAGGG - Intergenic
1189152107 X:38719614-38719636 AGAGCTCCCATACAATGGGAGGG + Intergenic
1192254867 X:69447881-69447903 AGAGCTCCCATACAATGGGAGGG - Intergenic
1192571966 X:72213437-72213459 AGAGCTCCCATACAATGGGAGGG - Intronic
1194333747 X:92618507-92618529 TGGGCTGTGGCACAATGCGATGG - Exonic
1194575422 X:95608447-95608469 AGATATGGGGCAGAATGGGAAGG - Intergenic
1195355386 X:104034735-104034757 AGGGCTGGGGGACAAGGGGAGGG - Intergenic
1196258182 X:113547306-113547328 AGAGCTCCCATACAATGGGAGGG + Intergenic
1199965741 X:152819166-152819188 AGAGCTATGGCACAATGCTATGG + Intergenic
1200642431 Y:5737509-5737531 TGGGCTGTGGCACAATGCGATGG - Intronic
1200698378 Y:6381309-6381331 AGAGCTCCTCCACAATGAGATGG + Intergenic
1200709426 Y:6470189-6470211 AGAGCTCCTCCACAATGAGAAGG + Intergenic
1200939878 Y:8770171-8770193 AGAGCTTCTCCACAATGAGAAGG + Intergenic
1201024686 Y:9694519-9694541 AGAGCTCCTCCACAATGAGAAGG - Intergenic
1201035736 Y:9783390-9783412 AGAGCTCCTCCACAATGAGATGG - Intergenic
1201962292 Y:19694815-19694837 AGAGCTCTCACACAATGGGAGGG + Intergenic